WormMine: Gene WBGene00061400

• WormBase Gene ID: WBGene00061400
• Gene Name: CRE03336
• Sequence Name: CRE03336
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zasp-like motif; PDZ domain; and PDZ superfamily. Is an ortholog of C. elegans alp-1. In C. elegans, alp-1 is involved in determination of adult lifespan and nematode pharyngeal pumping.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03336.1	CRE03336.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03336	CRE03336		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105235
• Remark: CRE03336, CAAATTGGAGGATTTGGACAATTTGGACATCAACGCTGTGGACAGACTTCTAGTTACAGC, WBGene00061400
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term