WormMine: Gene WBGene00026435

• WormBase Gene ID: WBGene00026435
• Gene Name: Cbr-pat-3
• Sequence Name: CBG03601
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Integrin beta subunit, VWA domain; Integrin domain superfamily; von Willebrand factor A-like domain superfamily; EGF-like domain; Integrin beta tail domain superfamily; Integrin plexin domain; Integrin beta N-terminal; Integrin beta subunit, tail; Integrin beta cytoplasmic domain; Integrin beta tail domain; Integrin beta subunit; Integrin beta subunit, cytoplasmic domain; Integrin beta chain VWA domain; and EGF-like domain, extracellular. Is an ortholog of C. elegans pat-3. In C. elegans, pat-3 is involved in several processes, including muscle cell cellular homeostasis; positive regulation of cellular component organization; and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03601.1	CBG03601.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03601	CBG03601		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055184
• Remark: Cbr-pat-3, ATAATGAGACTGAATGTGATAAGTGCGAATTCAAGGCGATTCCAGTGGATGAGCTGCCAA, WBGene00026435
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term