WormMine: Gene WBGene00133245

• WormBase Gene ID: WBGene00133245
• Gene Name: Cjp-ndx-8
• Sequence Name: CJA14041
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: NUDIX domain; NUDIX hydrolase domain; and NUDIX hydrolase-like domain superfamily. Is an ortholog of C. elegans ndx-8. In C. elegans, ndx-8 is involved in coenzyme A catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14041.1	CJA14041.1		[unknown]
Transcript:CJA14041.2	CJA14041.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14041	CJA14041		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079451
• Remark: Cjp-ndx-8, TCGTAGCGATTGGAGTGCTCACGAAGATTCCACAATTTAATTTGCTACCTAATTTTACGA, WBGene00133245
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term