WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030887 Gene Name  Cbr-dhs-16
Sequence Name  ? CBG09275 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Short-chain dehydrogenase/reductase SDR; short chain dehydrogenase; and NAD(P)-binding domain superfamily. Is an ortholog of C. elegans dhs-16. In C. elegans, dhs-16 is involved in steroid catabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09275.1 CBG09275.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09275 CBG09275   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dhs-16, AAGAAGAAGTCCAGTTCAATGGATCCAGTTGCTTTCTCAGCTGGCAATGATTCCATTGCT, WBGene00030887   Expr1059212 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term