WormMine: Gene WBGene00132704

• WormBase Gene ID: WBGene00132704
• Gene Name: Cjp-smk-1
• Sequence Name: CJA13500
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Phosphatase 4 regulatory subunit 3; Domain of unknown function DUF625; Armadillo-type fold; and PH-like domain superfamily. Is an ortholog of C. elegans smk-1. In C. elegans, smk-1 is involved in negative regulation of mitotic DNA damage checkpoint; response to radiation; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13500.1	CJA13500.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13500	CJA13500		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074532
• Remark: Cjp-smk-1, GAAAACGGACGAGCGACGGGCTTGACCCCACTGATGTGAAGCGAAGCCGCAAGGATGAAA, WBGene00132704
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term