WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00131592 Gene Name  Cjp-ints-6
Sequence Name  ? CJA12388 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans ints-6. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA12388a.1 CJA12388a.1   [unknown]
Transcript:CJA12388b.1 CJA12388b.1   [unknown]
Transcript:CJA12388c.1 CJA12388c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA12388b CJA12388b   [unknown]
CDS:CJA12388c CJA12388c   [unknown]
CDS:CJA12388a CJA12388a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-dic-1, AAGGAGCGAACGCACGCGTTTGGAAACCCGTACAAGCTAAAAGGAATGGGCGGGATTGAT, WBGene00131592   Expr1082437 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term