WormMine: Gene WBGene00030399

• WormBase Gene ID: WBGene00030399
• Gene Name: Cbr-srr-5
• Sequence Name: CBG08643
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function DUF267, Caenorhabditis species and Caenorhabditis protein of unknown function, DUF267. Is an ortholog of C. elegans srr-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08643.1	CBG08643.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08643	CBG08643		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061838
• Remark: Cbr-srr-5, GATGTAATCAACACTTATCATGTCATGATTGATAGATCATTGAGGCACACTGCTCGACTT, WBGene00030399
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term