WormMine: Gene WBGene00033342

• WormBase Gene ID: WBGene00033342
• Gene Name: Cbr-fog-3
• Sequence Name: CBG12385
• Organism: Caenorhabditis briggsae
• Automated Description: Expressed in male. Is an ortholog of C. elegans fog-3. In C. elegans, fog-3 is involved in cell fate specification; developmental process involved in reproduction; and positive regulation of oocyte development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12385.1	CBG12385.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12385	CBG12385		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr11505
• Pattern: The expression of C. briggsae fog-3 was highest during the L4 larval stage, when the animals produce sperm, but that expression was low during adulthood, when the animals make only oocytes.

• Primary Identifier: Expr1051638
• Remark: Cbr-fog-3, GTGCTACCGAGAATGGAGTCGATGTTCCAATCTGGAAAGGAGACGTGAATACTGATTCAC, WBGene00033342
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term