WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034493 Gene Name  CBG13790
Sequence Name  ? CBG13790 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans Y53F4B.62. Biotype  SO:0000336
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13790, CACGCTACCACATGTAGACGTTGTACGCAACTTAATCAGAAACGATGGAATGATTGGATC, WBGene00034493   Expr1061650 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term