WormMine: Gene WBGene00207466

• WormBase Gene ID: WBGene00207466
• Gene Name: CJA31619
• Sequence Name: CJA31619
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; RecF/RecN/SMC N terminal domain; and RecF/RecN/SMC, N-terminal. Is an ortholog of C. elegans mix-1. In C. elegans, mix-1 is involved in several processes, including dosage compensation by hypoactivation of X chromosome; mitotic chromosome condensation; and positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA31619.1	CJA31619.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA31619	CJA31619		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081438
• Remark: Cjp-mix-1, TTTTCTGCAGTTTATCATAGTCTCGCTGAAACAAGGAATGTTTTCGAACGCGGACACTTT, WBGene00125834
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term