WormMine: Gene WBGene00024877

• WormBase Gene ID: WBGene00024877
• Gene Name: Cbr-rpl-7A
• Sequence Name: CBG01675
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ribosomal protein L7Ae/L30e/S12e/Gadd45 family; Ribosomal protein L7Ae/L8/Nhp2 family; Ribosomal protein L7A/L8; Ribosomal protein L7Ae/L30e/S12e/Gadd45; and 50S ribosomal protein L30e-like. Is an ortholog of C. elegans rpl-7A.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01675.1	CBG01675.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01675	CBG01675		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067822
• Remark: Cbr-rpl-7A, GACAAGACATCCAGCCAAAGAGAGATGTTACCCGCTTCGTCAAGTGGCCTAAATACATCC, WBGene00024877
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term