2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001332 | eri-1 | T07A9.5 | Caenorhabditis elegans |
| WBGene00007091 | eri-12 | B0001.6 | Caenorhabditis elegans |
| WormBase ID | WBStrain00007911 | CGC Received | 2004-02-26 |
| Genotype | eri-1(mg366) IV. | Laboratory | CGC |
| Made By | WBPerson315 | Mutagen | EMS |
| Name | GR1373 | Outcrossed | x5 |
| Remark | Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366). | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001332 | eri-1 | T07A9.5 | Caenorhabditis elegans |
| WBGene00007091 | eri-12 | B0001.6 | Caenorhabditis elegans |
