WormMine: Gene WBGene00024051

• WormBase Gene ID: WBGene00024051
• Gene Name: Cbr-eff-1
• Sequence Name: CBG00700
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Type I membrane glycoproteins cell-cell fusogen; Cell-cell fusogen EFF/AFF; and Cell-cell fusogen EFF/AFF, domain 3. Is an ortholog of C. elegans eff-1. In C. elegans, eff-1 is involved in several processes, including anatomical structure morphogenesis; egg-laying behavior; and nematode pharyngeal muscle development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00700b.1	CBG00700b.1		[unknown]
Transcript:CBG00700a.1	CBG00700a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00700b	CBG00700b		[unknown]
CDS:CBG00700a	CBG00700a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069063
• Remark: Cbr-eff-1, GAAGTTGAATCCCAAAACCTTGTGTTCTTCCACAACGCTTCGCGCATCCGTGAATTCTCT, WBGene00024051
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term