WormMine: Gene WBGene00032062

• WormBase Gene ID: WBGene00032062
• Gene Name: Cbr-sem-4
• Sequence Name: CBG10785
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2 superfamily; Zinc-finger of C2H2 type; and Zinc finger C2H2-type. Is an ortholog of C. elegans sem-4. In C. elegans, sem-4 is involved in cell differentiation; regulation of gene expression; and response to oxidative stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10785.1	CBG10785.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10785	CBG10785		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053129
• Remark: Cbr-sem-4, TTCAAATGCGAAATGTGTGGTCGCGCCTTCACAACACGTGGCAATCTGAAAGTCCATATG, WBGene00032062
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term