WormMine: AnatomyTerm WBbt:0005741

• Definition: posterior region, from rectum to the end
• Name: tail
• Primary Identifier: WBbt:0005741

4 Children

Definition	Name	Synonym	Primary Identifier
An acellular thin cuticle whip formed at the very end of the tail during embryogenesis.	tail spike		WBbt:0006979
ganglion in the tail region (posterior to rectum).	tail ganglion		WBbt:0006977
hypodermis making up the tail.	tail hypodermis		WBbt:0006978
The adult male tail including the the lateral fan and rays. [WormAtlas]	bursa	adult male tail	WBbt:0008633

0 Expression Clusters

608 Expression Patterns

• Primary Identifier: Expr4825
• Remark: Picture: Fig. 10, J and K.
• Pattern: Expression of hex-5 was restricted to certain cells at the 3-fold stage but was also present in the vulval, head (muscle), and tail regions in larval and adult worms. Expressed throughout the life-cycle.

• Primary Identifier: Expr4290
• Pattern: Expressed in the intestine in adult worms, and in all four larval stages. The fat-5 promoter::GFP expressing lines showed additional expression in the pharynx and tail cells after hatching and throughout the lifespan.

• Primary Identifier: Expr4605
• Remark: Reporter gene fusion type not specified.
• Pattern: The GFP construct was broadly expressed throughout the animal with fluorescence strongest in the seam cells, body wall and pharyngeal muscle, vulval cells, spermatheca, the tail, and many neurons.

• Primary Identifier: Expr4490
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in ventral nerve cord from L2 to adult, anterior neurons (not individually identified in this study) from L2 to adult, posterior neurons from L2 to adult, pharynx from L2 to adult, specific pair of head neurons from L2 to adult, posterior cells (not individually identified in this study) from L2 to adult.

• Primary Identifier: Expr4489
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in ventral nerve cord from L2 to adult, anterior neurons (not individually identified in this study) from L2 to adult, posterior neurons from L2 to adult, pharynx from L2 to adult, mid body cell bodies from L2 to adult, specific pair of head neurons from L2 to adult, posterior cells (not individually identified in this study) from L2 to adult in some animals, main body hypodermis in some L2/L3 animals.

• Primary Identifier: Expr4473
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in anterior neurons (not individually identified in this study) from L2 to adult, pharynx from L2 to adult, specific pair of head neurons from L2 to L4, posterior cells (not individually identified in this study) from L2 to adult.

• Primary Identifier: Expr4474
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in anterior neurons (not individually identified in this study) from L2 to adult, intestine from L2 to adult, pharynx from L2 to adult, specific pair of head neurons from L2 to adult, posterior cells (not individually identified in this study) from L2 to adult.

• Primary Identifier: Expr4502
• Pattern: A transcriptional reporter for sel-2 in which the 5' upstream region drives nuclearly localized YFP is expressed in the VPCs and their descendants, as well as in many other cell types, including the epithelial cells of the intestine and the rectum, the seam cells, many cells in the head and the tail, and the cells of the ventral nerve cord.

• Primary Identifier: Expr5299
• Remark: Strain: BC12707
• Reporter Gene: [C18A3.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTCGTTCATAATGCTGCG] 3' and primer B 5' [TGAAGAAGGAGATGGCTTAAATG] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5291
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173
• Reporter Gene: [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5292
• Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998
• Reporter Gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5273
• Remark: Strain: BC10379
• Reporter Gene: [C16A3.10a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCTTTTGGTTGCAATTT] 3' and primer B 5' [GAGGGAGGACAAGATTCTGC] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5276
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14096
• Reporter Gene: [C16C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; amphids; unidentified cells in tail

• Primary Identifier: Expr5272
• Remark: Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066
• Reporter Gene: [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5260
• Remark: Strain: BC13890
• Reporter Gene: [C13G3.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAATACCCTAAAAATCCCAACA] 3' and primer B 5' [GAAATGATAAATATGAGGGCCG] 3'.
• Pattern: Adult Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5253
• Remark: Strain: BC10460
• Reporter Gene: [C13C4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACAAAGTGTGGAAAAGGGA] 3' and primer B 5' [TTTGTTTCTCACGATCGTTCAC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; hypodermis; excretory cell

• Primary Identifier: Expr5246
• Remark: Strain: BC11926
• Reporter Gene: [C12D8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGAATGTGTACGAACGATCTG] 3' and primer B 5' [TCCTTCGATTTGATTCACAAAGT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5237
• Remark: Strain: BC11515
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; unidentified cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; unidentified cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5234
• Remark: Strain: BC14107
• Reporter Gene: [C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail

• Primary Identifier: Expr5236
• Remark: Strain: BC12473
• Reporter Gene: [C10H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGAATGAACGGAGGGAC] 3' and primer B 5' [GCGATGATCAAATGATCTGAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5221
• Remark: Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. Strain: BC12217
• Reporter Gene: [C09F5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCAGCGTTTTCAACTGAT] 3' and primer B 5' [CGTGTGAACGAGGGATCTG] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; spermatheca; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5223
• Remark: Strain: BC13281
• Reporter Gene: [C09G12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTTTTCACCAAGTTTGC] 3' and primer B 5' [TGGGCCGAGATGAGGTAG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5219
• Remark: Strain: BC10423
• Reporter Gene: [C09E9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAACTCGGCTGATTGGAA] 3' and primer B 5' [GGCCGATGATTTGTAACTGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; unidentified cells in tail

• Primary Identifier: Expr5200
• Remark: Strain: BC10784
• Reporter Gene: [clh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGTAGTTCGCCCGTTAAT] 3' and primer B 5' [TCGGCTGGAATAAAAGAACAAT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5203
• Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. Strain: BC12754
• Reporter Gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5195
• Remark: Strain: BC14465
• Reporter Gene: [C06H2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCAAAGAAAAGGATAGTTCCA] 3' and primer B 5' [CGCCAGCTGATCTGGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5185
• Remark: Also expressed in (comments from author) : This strain is an UNC. Strain: BC12544
• Reporter Gene: [stdh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTGACCCTATTCAACAAAA] 3' and primer B 5' [TGTCGAAGATTTTAGCAAAATTAG] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5186
• Remark: Strain: BC11648
• Reporter Gene: [nhr-50::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGAATATCAAGAGAGGGCGA] 3' and primer B 5' [GTAGATCAGCTGAAAGTGCAGAGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Nervous System; head neurons; unidentified cells in tail

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738