WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr5356 Remark  Strain: BC15580
Reporter Gene  [C27D6.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGTGAGATCAGATTCAGCGA] 3' and primer B 5' [ACGTGTCGCGATCGTCTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016162 crh-2 C27D6.4 Caenorhabditis elegans

0 Life Stages