WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr5077 Remark  Strain: BC11780
Reporter Gene  [B0496.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGGACCGGTTTTTCTCT] 3' and primer B 5' [GACAGTTTGGCATGATTATTACGA] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00015216 valv-1 B0496.7 Caenorhabditis elegans

0 Life Stages