WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr5018 Remark  Also expressed in (comments from author) : Only embryonic expression Strain: BC11774
Reporter Gene  [his-48::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTCGTGATGGAACTTCTACCC] 3' and primer B 5' [TGGGATGATGAGAATGAACTTG] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001922 his-48 B0035.8 Caenorhabditis elegans

0 Life Stages