WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr7244 Remark  Strain: BC10376
Reporter Gene  [ZK688.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGTAATGCAAATTAGAAAAATGACC] 3' and primer B 5' [AACGAGAGTTATTTATTCCTGCTG] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00022801 pcp-5 ZK688.6 Caenorhabditis elegans

0 Life Stages