WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr7190 Remark  Strain: BC11168
Reporter Gene  [ZK1127.9b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGCCCATTCTCTTCTTCATC] 3' and primer B 5' [ATTTTCGTGGCTGATCTGTAAAA] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00022855 tcer-1 ZK1127.9 Caenorhabditis elegans

0 Life Stages