WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr7206 Remark  Also expressed in (comments from author) : GFP in embryo only Strain: BC14014
Reporter Gene  [ZK353.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCTTGTCGCCTGTGATTC] 3' and primer B 5' [unknown] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00022702 cutc-1 ZK353.7 Caenorhabditis elegans

0 Life Stages