WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr5671 Remark  Also expressed in (comments from author) : Bright gfp in putative rectal gland cells, occasional gfp in nose sheath cells. No neuronal expression. (Hobert Lab 2005) Strain: BC13421
Reporter Gene  [str-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGACGTCATTCGCACAA] 3' and primer B 5' [AATGAGGGATGGAGGATATGG] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006112 str-47 F07C4.1 Caenorhabditis elegans

0 Life Stages