1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000461 | ceh-40 | F17A2.5 | Caenorhabditis elegans |
| Primary Identifier | Expr5779 | Remark | Also expressed in (comments from author) : Strain not available. Unable to complete analysis. Strain: BC10765 |
| Reporter Gene | [ceh-40::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCATTTCCAATAATGACGTGAA] 3' and primer B 5' [ACGCCTCACTGATGTCTACAATAA] 3'. |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000461 | ceh-40 | F17A2.5 | Caenorhabditis elegans |
