WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr5881 Remark  Also expressed in (comments from author) : Embryo only. Strain: BC12504
Reporter Gene  [F26F4.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGATGACGTTTCCGAGAAGAT] 3' and primer B 5' [AGTTGTCAAAAGGTCACGGG] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00005011 F26F4.8 F26F4.8 Caenorhabditis elegans

0 Life Stages