WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr6230 Remark  Strain: BC12902
Reporter Gene  [rps-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGATTATGAGCGTCGGAAGT] 3' and primer B 5' [CGATGATTGAAGCGGATTG] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004470 rps-3A F56F3.5 Caenorhabditis elegans

0 Life Stages