WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Hide

Oops!

http://intermine.wormbase.org/tools/wormmine/service/ is incorrect

Expression Pattern :

Pattern  Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells. Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells; Primary Identifier  Expr9565
Reporter Gene  The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. Subcellular Localization  Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other

12 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
a large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring. ventral nerve cord ventral cord WBbt:0005829
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
intestinal muscle cell, attach to intestine and body wall anterior to anus intestinal muscle stomato-intestinal muscle WBbt:0005796
a bundle of nerve processes that runs along the dorsal mid-line of the animal. dorsal nerve cord dorsal cord WBbt:0006750

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016792 C49H3.6 C49H3.6 Caenorhabditis elegans

0 Life Stages