| Pattern | Nuclear localised expression in a restricted subset of hypodermal cells. A strain generated with a pool of plasmids gave expression in the anterior and posterior seam cells only. | Primary Identifier | Expr53 |
| Remark | Fusion junction ...CCCAATTTAAAGTTTTCCAAACATGTTTCAGCCAAGCCAATACCATTCACCAGGATTACCTTGAAACCG TTGAAAAATTATACAAAGCTTCGGGTGAAAGCCTCGATTTTTCTCAGACCGAACAAGCGGCAAAGGTGCATC ATGCTCGCCCGTTTTCCATAATATTCCACTTTCAGACCATGAACACCTTTGTGGAAAATCATACAAATGGAA AGATC/lacZ This Expression pattern was attached to a sequence (C05E4.k) which has been replaced with a numbered suffix the details of which were temporarily lost. However, we now believe that .k became C05E4.1. Other authors: Author "Arnold JM" "Herbert R" "Hope IA"Date 1993-01. |
| Definition | Name | Synonym | Primary Identifier |
|---|---|---|---|
| a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail | seam cell | lateral hypodermis | WBbt:0005753 |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00005643 | srp-2 | C05E4.1 | Caenorhabditis elegans |
