WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr7233 Remark  Strain: BC12401
Reporter Gene  [cdc-25.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGAAGACGTCGCCTTTTTAG] 3' and primer B 5' [TCAACGCAGATCAGGAGACTT] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000388 cdc-25.3 ZK637.11 Caenorhabditis elegans

0 Life Stages