WormMine: AnatomyTerm WBbt:0008182

• Definition: These cells include: B, F, Y, U, K' and K. All rectal epithelial cells contain secretory membrane stacks along this region facing the lumenal cuticle and produce some portion of the cuticular lining of the rectum. These are interfacial cells that connect the alimentary system to the main body syncytium.
• Name: rectal epithelial cell
• Primary Identifier: WBbt:0008182
• Synonym: rectal epithelium

7 Children

Definition	Name	Synonym	Primary Identifier
Rectal cell, postembryonic blast cell in male	B cell	lineage name: ABprppppapa	WBbt:0003825
Rectal cell, blast cell in male	F cell	lineage name: ABplppppapp	WBbt:0004799
Rectal cell, postembryonic blast cell	K cell	lineage name: ABplpapppaa	WBbt:0004499
Rectal cell, postembryonic blast cell in male	U cell	lineage name: ABplppppapa	WBbt:0004942
Rectal cell	K' cell	lineage name: ABplpapppap	WBbt:0004497
Rectal cell at hatching, becomes PDA in hermaphrodite, postembryonic blast cell in male	Y cell	lineage name: ABprpppaaaa	WBbt:0004578
Rectal cell	K.a	lineage name: K.a	WBbt:0004495

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 30_1 expressed in hypodermis.	scVI 0.6.0	WBPaper00065841:30_1
	Single-cell RNA-Seq cell group 82_1 with unidentified tissue expression pattern.	scVI 0.6.0	WBPaper00065841:82_1

44 Expression Patterns

• Primary Identifier: Expr12798
• Pattern: tat-3 reporter signal first appears in embryos in the developing pharynx. In the fully formed alimentary system, very strong GFP fluorescence is observed in the muscle, marginal and buccal epithelial cells of the pharynx, the pharyngeal-intestinal valve and, with lesser intensity, the rectal epithelial cells. Seam cells display very strong fluorescence as soon as this lineage becomes established during embryonic development. In adults, moderate to weak fluorescence seems to arise from the XXX cells, some unidentified cells in the head and tail regions and the hypodermis. In the reproductive system, tat-3 reporter expression begins in the distal tip cells (DTC) in L1 and in the anchor cell (AC) in early L3. GFP signal is later visible in the dividing progeny of the vulval precursor cells (VPCs). In late L4, the anchor cell fuses with the uterine seam cell (utse), which does not express the reporter. The vulval cells continue exhibiting moderate fluorescence into the adulthood.

• Primary Identifier: Expr9390
• Pattern: The LTD-1::GFP signal is present throughout the development of C. elegans. This signal was detected as early as the 2-fold embryo. The ltd-1 reporter is also expressed throughout the seam cell division process. Its expression is observed in the seam cells of the early embryo and in the larval stages once these cells have commenced division. The LTD-1::GFP signal is also observed in rectal epithelial cells (tentatively, U and Y cells) and in the terminal bulb (marginal cells) and isthmus of the pharynx from hatching to adulthood.
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Dense bodies, Cytoplasm, +/- Nucleus The LTD-1::GFP construct is expressed in the apical regions of the dorsal and ventral hypodermis in very tightly organized circumferential filament bundles. This cytoskeletal expression pattern mirrors the intracellular distribution of actin and tubulin in C. elegans. In late embryos, the GFP signal is localized to the apical junction between hyp 5, hyp 6 and hyp 7 and between the seam cells and the P blast cells in the ventral midline. This signal highlights the cell fusion processes that take place during post-embryonic development. The ltd-1 reporter is also expressed throughout the seam cell division process. It clearly outlines the cytokinesis between posterior mother cells and anterior daughter cells and illustrates the subsequent fusion of the anterior daughter cells to the hypodermal syncitium. The GFP signal is also observed in longitudinal filaments within the cytoplasm linking both extremities of the elongating seam cells and in the alae formed by their fusion.

• Primary Identifier: Expr9452
• Remark: Operon: CEOP1368
• Pattern: Animals bearing the transcriptional and translational reporters had similar GFP expression patterns. L1 animals carrying the translation reporter expressed GFP in many neurons, including CANs, DD-type motoneurons and ALMs. Expression in the nervous system began early in comma-stage embryos and peaked in intensity around the 3-fold stage of embryogenesis. Although neuronal expression was much fainter at later larval stages, it persisted in some head and tail neurons through adulthood. Non-neuronal cells that also expressed CRML-1::GFP included the migrating distal tip cells, the pharynx, some vulval epithelial cells, rectal epithelial cells and the excretory canal.
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms

• Primary Identifier: Expr9224
• Pattern: mtm-9::gfp reporter was expressed in a broad range of tissues, including the muscle, intestine, hypodermis and neurons (including the CAN neuron in the mid-body region). Mtm-9 was also expressed in the rectal epithelial cells that are the major source of EGL-20 Wnt.

• Primary Identifier: Expr11585
• Pattern: Head Paak-2::GFP expression is mostly seen in the excretory cell but is also observed in pharyngeal neurons, epithelial cells, a subset of ring neurons, amphid socket cells and head body wall muscles. Paak-2::GFP is also expressed in the posterior intestine, rectal gland and epithelial cells, and in phasmids. Paak-2::GFP is detected in vulval muscles. For a summary of Paak-2::GFP see table S10.

• Primary Identifier: Expr13334
• Pattern: In hermaphrodites and males, selt-1.1 GFP expression was observed in neurons, epithelial and muscle cells of transgenic animals carrying both transcriptional (i.e. selt-1.2 promoter driving GFP expression) and translational (i.e. containing selt-1.2 promoter, exons and introns driving GFP expression) constructs. Crosses with the pan-neuronal marker rab-3 fused to the red fluorescent protein (RFP) in the nuclei confirmed that SELT-1.1 is expressed in all neurons of the nervous system. The expression of selt-1.1 in the ADL, ASH, ASI, ASJ, ASK, AWB amphid sensilla neurons was also confirmed by DiI staining. In the epithelia, selt-1.1 is expressed in the hypodermal, arcade, pharyngeal, vulval and rectal cells. selt-1.1 was not found to be expressed in the intestine or in the gonad. Muscle cells expressing selt-1.1 include the somatic muscle cells from head, neck and body wall as well as the non-striated pharyngeal muscles. SELT-1.1 expression was observed throughout development, from pre-bean embryonic stages to the adult stage. Embryos expressed GFP in most cells, also with a perinuclear localization.
• Subcellular Localization: The translational Pselt-1.1::selt-1.1::gfp reporter revealed perinuclear localization, consistent with the ER localization previously reported for mammalian SELENOT. The ER localization of SELT-1.1 was confirmed by expressing into the QW1266[Pselt- 1.1::selt-1.1::gfp] the ER marker tram-1 fused to mcherry in muscle cells.

• Primary Identifier: Expr10766
• Pattern: SHN-1::GFP expressed from embryo to adult. SHN- 1::GFP is expressed in neurons including nerve cords, pharynx, pharyngeal-intestinal valve, intestine, vulva, rectal epithelial cells, tail ganglia and male tail. SHN-1 protein is expressed from the embryonic stage to adulthood and tissue localization overlapped with SHN-1::GFP expression patterns in the pharynx, pharyngeal-intestinal valve, intestine, nerve cords, and tail region in addition to sperm.
• Subcellular Localization: Immunogold electron microscopy in wild-type hermaphrodites and males showed signals in the vesicle-like structures of intestinal and pharyngeal cells, and in the tail region, and most clearly seen in the male germline in developing sperm and in the presumptive pseudopodia, structures for motility of mature sperm.

• Primary Identifier: Expr9186
• Remark: Reporter gene fusion type not specified.
• Pattern: Expression of trxr-1::gfp reporter was seen in the hypodermis, in the pharynx and within the nervous system. TRXR-1::GFP reporter is expressed in tissues implicated in molting. TRXR-1::GFP is expressed in pharyngeal muscle, seam cells, and weakly in the hypodermis. Additional expression is observed in rectal epithelial cells and in the posterior part of the intestine. Expression is detected in one of a pair of cells that lie in the anterior head region ; their position and morphology are consistent with them being amphid sheath cells. TRXR-1::GFP is expressed in neurons within the nerve ring.

• Primary Identifier: Expr9532
• Remark: Operon: CEOP1360
• Reporter Gene: The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons. Larval Expression: intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; gonad sheath cells; body wall muscle; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Mitochondria

• Primary Identifier: Expr9790
• Pattern: Very strong nuclear-localized GFP was seen throughout development but most strongly in the L1. Expression was observed in possibly all neurons (in the head, the tail, and ventral nerve cord) as well as in the intestine, hypodermis, body wall muscle and rectal cells. GFP expression may be present in all cells.

• Primary Identifier: Expr9808
• Pattern: Very strong nuclear-localized GFP was seen throughout development but most strongly in the L1. Expression was observed in possibly all neurons (in the head, the tail, and ventral nerve cord) as well as in the intestine, hypodermis, body wall muscle and rectal cells. GFP expression may be present in all cells.

• Primary Identifier: Expr9949
• Pattern: EGG-6::GFP was expressed in a subset of epithelial cells, including epidermal, vulval and rectal cells and the excretory duct and pore. EGG-6::GFP was also observed in some neurons. Expression began around the ventral enclosure stage of embryogenesis and continued through larval development, but then decreased in adulthood. Expression was absent from internal epithelia such as the gut and pharyngeal tubes.
• Subcellular Localization: In almost all epithelia where it was expressed, EGG-6::GFP appeared strongly apically enriched. In the excretory duct and pore, EGG-6::GFP lined the luminal membrane. In the epidermis, it was distributed across the apical surfaces of most dorsal and ventral epidermal cells but was observed more weakly or variably in the lateral (seam) epidermis. The fusion was not strongly enriched at apical junctions based on co-visualization with DLG-1/Discs Large::mcherry. The fusion protein partially overlapped with but did not strongly colocalize with transepidermal intermediate filaments at hemidesmosomes. The fusion was present in many large puncta, potentially representing a vesicular compartment trafficking to or from the membrane.

• Primary Identifier: Expr14213
• Remark: Other Strains: OH14272
• Pattern: Rectal epithelial cells, head and tail hypodermis, vulva, seam cells, PVT. There is some neuronal exp but it's variable and dim

• Primary Identifier: Expr11020
• Pattern: Examination of transgenic animals bearing the transcriptional fusion revealed that pan- 1prom::GFP is expressed in most somatic tissues. Expression was observed in all developmental stages from embryos undergoing morphogenesis to gravid adults. pan- 1prom::GFP exhibited strong expression in body wall muscle, vulva, somatic gonad and pharynx. Expression was also observed in the nerve ring, hypodermis, and rectal epithelia. Expression in the intestine was typically not observed or very weak. With respect to spatial expression, the pattern of pan-1FL::GFP was the same as pan-1prom::GFP with some notable exceptions. First, PAN- 1FL::GFP exhibited differences in expression intensity depending on the developmental point within the intermolt period. PAN-1FL::GFP was substantially qualitatively brighter at the mid to late intervals of the intermolt. Early in the intermolt bright expression of PAN- 1FL::GFP was typically only observed in the pharynx. Expression was also weak in the adult with the pharynx being the predominant expressing tissue. The other difference with respect to expression is that PAN-1FL::GFP was observed in the intestine, especially when expression was bright towards the end of the molt.
• Subcellular Localization: PAN-1FL::GFP exhibited a punctate localization in expressing cells. In the vulva and somatic gonad epithelia (spermatheca and uterus), these punctae were concentrated on the apical (luminal) surface of these cells. During embryonic pharyngeal development, PAN-1FL::GFP was found in the apical pharyngeal epithelium, as indicated by co-staining with the monoclonal antibody MH27 which recognizes the adherens junctions of epithelial cells. The localization in apical regions of epithelial cells is consistent with membrane association of the PAN-1B isoform. Additionally, immunolocalization data for PAN-1 indicate membrane association in intestinal cells. Cytoplasmic expression of GFP is also observed (likely corresponding to PAN-1A or PAN-1C); especially in the pharynx but also in other cell types. However, apparent cytoplasmic expression was not consistently observed indicating that some cell types may only express cytoplasmic isoforms of PAN-1 at certain developmental times.

• Primary Identifier: Expr3222
• Remark: Reporter gene fusion type not specified.
• Pattern: Epidermis: ncr-1Ap(l)::gfp was strongly expressed in the excretory cell and rectal epithelial cells from the early L1 larval stage and through all life stages. Seam cell expression was first observed in the late L1 stage, while expression in the lateral hypodermis increased during the L3 stage and peaked during the L4 stage. Seam cell and hypodermal expression gradually decreased in the adult stage and was hardly visible among older adults. ncr-1Ap(s)::gfp was not expressed in the hypodermis under normal growth conditions, though lateral hypodermal but not seam cell expression was dramatically upregulated in starved animals of all developmental stages. No increase in hypodermal expression was seen in starved ncr-1Ap(l)::gfp animals. Intestine: Both ncr-1Ap(s)::gfp and ncr-1Ap(l)::gfp were strongly expressed throughout the intestine, with posterior intestinal expression consistently stronger than anterior expression. Musculature: ncr-1Ap(l)::gfp was strongly expressed in pharyngeal muscles, but not in body wall muscles. Nervous system: ncr-1Ap(s)::gfp and ncr-1Ap(l)::gfp were expressed in the same set of head and tail neurons and a pair of neuron-like cells identified as the XXX cells. According to their location and cellular morphology, the head neurons were identified as the pharyngeal neuron I6, the inner labial sensory neurons IL2s and the amphid neurons ASE and ASG. The expression level in the amphid neurons was weaker than in the other head neurons. The tail neurons were identified as PHC, in which expression was first detected during the L2 stage, consistent with the time of birth of the neurons at the end of L1. In contrast to the widespread expression of ncr-1Ap::gfp, ncr-1Bp::gfp is expressed exclusively in 10-12 pairs of head and tail neurons. The tail neurons were identified as PHA, PHB and DVC. One pair of head neurons was identified as AWC. The other head neurons were very tentatively identified as RIC, RIM, FLP, ADA, ADE, RID and maybe AIY. We also occasionally observed expression in a pair of head cells anterior to the nerve ring. The position and morphology of these cells are similar to the XXX cells. With the exception of PHC neurons, expression in the tissues above was first observed during late embryogenesis and did not change during development. Somatic gonad: Both ncr-1Ap(s)::gfp and ncr-1Ap(l)::gfp were strongly expressed in the spermatheca and weakly in the gonadal sheath cells. The expression in the somatic gonad could be observed only in adults. Three reporter constructs, ncr-1Ap(s)::gfp, ncr-1Ap(l)::gfp and ncr-1Bp::gfp were made for ncr-1 because of its complex gene structure. The results indicate that ncr-1 expression is widespread and largely coincides with the reported distribution pattern of cholesterol in C. elegans, which includes the following tissues: intestine, pharynx, excretory gland cell, nerve ring, spermatheca and germ cells, including both oocytes and sperm.

• Primary Identifier: Expr11824
• Pattern: In uninfected animals, HLH- 30::GFP protein was expressed throughout development. In L4 larvae and young adults expression was highest in the intestine, rectal epithelial cells, vulval epithelial cells, spermathecae, and pharynx and absent from the gonads.
• Subcellular Localization: The GFP signal was equally distributed between nucleus and cytoplasm of expressing cells, suggesting that HLH-30 may reside in both compartments in uninfected animals.

• Primary Identifier: Expr16444
• Pattern: bus-10 exhibited expression in many tissues, most notably the seam cells, pharynx, intestine, rectal cells, and excretory gland.

• Primary Identifier: Expr12985
• Pattern: Transgenic worms expressing a translational GFP fusion spanning a 2.2kb fragment of the gsr-1 promoter plus the complete gsr-1 genomic ORF, showed strong fluorescence in pharynx while weaker labeling was found in hypodermis, intestine, vulva muscle cells, spermatheca, uterine cells, coelomocytes, gonad sheath cells, rectal cells and a couple of unidentified neurons (probably PVPL/R) in the tail.

• Primary Identifier: Expr9443
• Pattern: Neuronal expression: cholinergic & GABAergic motor neurons, head, tail & body. Non-neuronal expression: pharynx, intestine, vulval muscle.
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms Synaptic expression, co-localized with SNB-1::RFP.

• Primary Identifier: Expr9686
• Pattern: snx-3 is ubiquitously expressed in C. elegans, with prominent expression in coelomocytes, the pharynx and rectal epithelial cells.

• Primary Identifier: Expr11322
• Pattern: Adult: strong expression in vulval epithelium, gut, head muscle, pharynx: pm1,6,7,8, I3(?), a few more pharyngeal cells (neurons? epithelium); some arcade cells, excretory duct cell, 4 neurons in the retrovesicular ganglion, rectal glands, one additional rectal cell; occasionally hyp (expresses strongly in young larvae)

• Primary Identifier: Expr9798
• Pattern: GFP was expressed in many neurons in the nerve ring and elsewhere in the head. GFP was also observed in the procorpus of the pharynx, in rectal cells and in hypodermal cells in larvae and adults. There was extensive GFP expression in the developing reproductive system from the L3 stage which was maintained into adulthood.

• Primary Identifier: Expr9801
• Pattern: GFP was expressed in many neurons in the nerve ring and elsewhere in the head. GFP was also observed in the procorpus of the pharynx, in rectal cells and in hypodermal cells in larvae and adults. There was extensive GFP expression in the developing reproductive system from the L3 stage which was maintained into adulthood.

• Primary Identifier: Expr9841
• Pattern: GFP was expressed in many neurons in the nerve ring and elsewhere in the head. GFP was also observed in the procorpus of the pharynx, in rectal cells and in hypodermal cells in larvae and adults. There was extensive GFP expression in the developing reproductive system from the L3 stage which was maintained into adulthood.

• Primary Identifier: Expr14231
• Remark: Other Strain: OH14284
• Pattern: BAG, few head neurons ,sometimes PVT, 2 big cells close to the nose, rectal epithelial cells

• Primary Identifier: Expr12440
• Pattern: sox-2::gfp was expressed in the nucleus of both AWC and AWB neurons. The expression of sox-2 in AWC and AWB is maintained throughout life. sox-2 is also continuously expressed in other sensory neurons (IL1, IL2, URA, URB, OLL), interneurons (AIM, AIN, AVK, RIH), and motor neurons (RME), as well as in other tissues such as head hypodermis, arcade cells, and rectal epithelial cells.

• Primary Identifier: Expr862
• Remark: Reporter gene fusion type not specified.
• Pattern: At the L1 larval stage CEH-6ceh-6 is expressed in four pairs of bilaterally symmetric neurons in the lateral ring ganglion of the animal. These neurons are the RMDDLR, RMDVLR, AUALR and AVHLR neurons. The expression in RMDD and RMDV is weaker than in AUA and AVH. ceh-6 is also expressed in the excretory cell, very strongly with the lacZ reporter construct but more weakly with the antibody, which is probably due to the large volume of the nucleus. Despite the nuclear localization signal in the lacZ construct, the beta-galactosidase was occasionally expressed at such high levels that the excretory canals were also stained. Posterior to the excretory cell, the neurons SABVLR in the retro-vesicular ganglion express CEH-6ceh-6. Additional CEH-6-expressing cells in the body and tail were observed only with the antiserum, indicating that the ceh-6 reporters may not contain all promoter elements. In the body region, expression was observed in dividing P.na cells in the ventral nerve cord in L1 animals. The Pn.a expression is transient, appearing before the cell division of Pn.a and fading in the daughter cells. During the cell division, CEH-6 is localized to the cytoplasm of the dividing cells. It appears that the posterior daughters lose CEH-6 before that of the anterior daughter, as seen in the anterior Pn.ap cells. In the tail, CEH-6 expression in L1 animals is seen around the rectum in the five rectal cells B, Y, U, F and K. After K has divided, only the rectal cell K.a expresses CEH-6, though expression during the division was not monitored. At the L2 stage, a sixth cell becomes apparent that, based on its position at the very bottom of the rectum, is deduced to be P12.pa. Head and rectal expression of CEH-6 persists into adulthood. In addition, in adult animals four symmetric CEH-6 expressing cells are seen around the vulva, possibly one set of the vul cells, though did not determine their identity. During embryogenesis ceh-6 is expressed at the comma stage in two clusters one cluster corresponds to the ectodermal cells surrounding the anus (B, Y, U, F and K), and the other cluster corresponded to the cells in the head described above, many of which are located relatively close to each other at that stage in development.

• Primary Identifier: Expr12602
• Pattern: sox-3, was not observed in neuroblasts but was observed in several differentiated postmitotic neurons, such as ASK, OLQ, SAA, SMB. sox-3 is co-expressed with sox-2 in the rectal epithelial cells but its expression is undetectable in seam cells or other blast cells.

• Primary Identifier: Expr12273
• Pattern: Among all the head neurons, SPTF-1 is exclusively expressed in ASJ neurons. In addition, SPTF-1 is also expressed in non-neuronal cells of the animal such as pharyngeal cells, rectal and intestinal cells, seam cells and vulva epithelial cells.

• Primary Identifier: Expr3124
• Pattern: Bright fluorescence was observed in the Hyp5 hypodermal cell at the anterior end of the larvae as well as at other attachment points of the cuticle at the anterior end of larvae, in the arcade cells in the mouth, the anterior pharynx and the amphid socket cells, and in the rectal epithelial cells at the posterior end of the larvae. Bright fluorescence was also observed in the hypodermal cells of each larval stage. Expression was not seen in the seam cells of L1 through L3 larvae; however, the seam cells of the L4 larvae strongly expressed nas-37::GFP. The L4 stage is when the seam cells terminally differentiate and fuse with the hypodermal syncytium. The expression in the hypodermis and seam cells disappeared in adult worms after a few hours. However, expression continued in the vulval epithelial cells and the rectal epithelial cells in the adult.

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
an epithelial cell that serves either to bridge two neighboring epithelial tissues or to form an opening in the epithelium.	interfacial epithelial cell	interfacial cell	WBbt:0005754