WormMine: AnatomyTerm WBbt:0006865

• Definition: somatic cell that situates at the tip of a gonad arm.
• Name: distal tip cell
• Primary Identifier: WBbt:0006865
• Synonym: DTC

2 Children

Definition	Name	Synonym	Primary Identifier
one of a pair of cells, situates at the distal tip of the male gonad.	male distal tip cell	gon_male_dtc	WBbt:0006864
somatic gonad cell that situates at the distal tip of the hermaphrodite gonad.	hermaphrodite distal tip cell		WBbt:0006863

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 58 expressed in: Distal tip.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:58

161 Expression Patterns

• Primary Identifier: Expr4892
• Remark: Picture: Figure 4A, B, D.
• Pattern: INA-1::GFP was present in the DTCs at the L2 stage prior to migration and maintained throughout L4. In wild-type N2 adults, INA-1::GFP was down-regulated with the cessation of migration (2% GFP-positive, n = 49).

• Primary Identifier: Expr4218
• Remark: Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).
• Pattern: In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.

• Primary Identifier: Expr4590
• Pattern: Promoter activity with distinct GFP expression in lateral hypodermal seam cells and in the non-seam cell hypodermis was observed throughout development. Additionally, expression was noted in many neurons, including the ventral nerve cord (VNC) and the hermaphrodite specific neuron (HSN). GFP was also observed in various somatic gonad tissues including the anchor cell in larval stages and adult vulval muscle cells, the distal tip cells, a subset of the vulval precursor cells, uterine cells, and spermatheca.

• Primary Identifier: Expr14500
• Pattern: Available expression reporters for lin-40, sec-10, and copa-1 were expressed in the DTC.

• Primary Identifier: Expr9674
• Pattern: Pprkl-1::GFP was only consistently detected in VC1-6 and the HSN neurons and a small subset of neurons in the head and ventral nerve cord. In non-neuronal tissue, prkl-1 promoter activity was detected in somatic gonad cells, uterine cells, distal tip cells, and vulval cells.

• Primary Identifier: Expr14614
• Pattern: Native GFP::CATP-7, as well as CATP-6::mKate2 are expressed in the DTCs of early stage gonads. Native GFP::CATP-7 and native CATP-6::mKate2 are also both expressed in the DTCs of L4 animals, although the CATP-6 expression is comparatively weak.

• Primary Identifier: Expr16100

• Primary Identifier: Expr11809
• Pattern: Robust GFP expression of pnc-1a::exon1a::GFP was detected in head and pharyngeal muscle, the two ASK neurons, the two distal tip cells and the three rectal gland cells (RectD, RectVL and RectVR). Whereas the four uv1 cells did not express pnc-1a::exon1a::GFP, four adjacent uv2 cells had moderate levels of GFP expression. Low levels of pnc-1a::exon1a::GFP expression were also detected in the vulval muscle. The pnc-1a reporter overlaps in expression pattern with the pnc-1b reporter only in head muscle and perhaps vulval muscle.

• Primary Identifier: Expr12798
• Pattern: tat-3 reporter signal first appears in embryos in the developing pharynx. In the fully formed alimentary system, very strong GFP fluorescence is observed in the muscle, marginal and buccal epithelial cells of the pharynx, the pharyngeal-intestinal valve and, with lesser intensity, the rectal epithelial cells. Seam cells display very strong fluorescence as soon as this lineage becomes established during embryonic development. In adults, moderate to weak fluorescence seems to arise from the XXX cells, some unidentified cells in the head and tail regions and the hypodermis. In the reproductive system, tat-3 reporter expression begins in the distal tip cells (DTC) in L1 and in the anchor cell (AC) in early L3. GFP signal is later visible in the dividing progeny of the vulval precursor cells (VPCs). In late L4, the anchor cell fuses with the uterine seam cell (utse), which does not express the reporter. The vulval cells continue exhibiting moderate fluorescence into the adulthood.

• Primary Identifier: Expr11299
• Pattern: Expressed in body wall muscle, pharyngeal muscle and marginal cells, gut, distal tip cell, uterus, CAN, excretory cell (not visible on most images), coelomocytes, several neuronal and non-neuronal cells in head and tail, strong expression at all stages including embryos

• Primary Identifier: Expr12085
• Pattern: plr-1::GFP expression became visible in late gastrulation stage embryos. Strongest expression was detected in many cells in the tail region and by comma stage the most prominent expression was seen in body wall muscle cells. In early larval stages expression was detectable in a number of different tissues including the major hypodermal cells, muscle and marginal cells of the pharynx, the intestine (strongest in the anteriormost and posteriormost cells) as well as the anal depressor and stomatointestinal muscle. In the nervous system GFP expression was visible in a few neurons in head ganglia, many ventral cord motor neurons and several neurons in the tail ganglia including the PDA neuron. Based on the lack of commissures the motor neurons are likely of the VA, VB, VC and/or AS class. Based on the number of cells the majority (or even all) of these classes express GFP. In general expression was strongest in the tail region throughout development. This also held true for the motor neurons in the ventral cord, where GFP was strongest in the posterior-most cells and barely detectable in anterior motor neurons. Expression is maintained throughout larval development. In later larval stages expression is also seen occasionally in the distal tip cell of the developing gonad, the vulva and uterine muscle cells and the VC4 and VC5 neurons flanking the vulva. Expression in AVG, HSN or CAN neurons was not detectable with this reporter construct, but was detected in a previous study in HSN and CAN using a longer genomic construct (Moffat et al., 2014, Expr11480).

• Primary Identifier: Expr9452
• Remark: Operon: CEOP1368
• Pattern: Animals bearing the transcriptional and translational reporters had similar GFP expression patterns. L1 animals carrying the translation reporter expressed GFP in many neurons, including CANs, DD-type motoneurons and ALMs. Expression in the nervous system began early in comma-stage embryos and peaked in intensity around the 3-fold stage of embryogenesis. Although neuronal expression was much fainter at later larval stages, it persisted in some head and tail neurons through adulthood. Non-neuronal cells that also expressed CRML-1::GFP included the migrating distal tip cells, the pharynx, some vulval epithelial cells, rectal epithelial cells and the excretory canal.
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms

• Primary Identifier: Expr12957
• Pattern: In adults, rsu-1 was found expressed in somatic BWMs and in nonstriated pharyngeal and vulval muscles. It was also detected in a subset of neurons of the ventral cord, in the gonad distal tip cells, and, in some transgenic lines, in epithelial cells.

• Primary Identifier: Expr9183
• Pattern: UEV-1 is broadly expressed in the pharynx, neurons, muscle cells, vulva, embryos, intestine, and in the anus/tail. We found strong expression in the distal tip cell. We also found expression in the motoneurons that line the ventral cord.
• Subcellular Localization: We noted that the UEV-1::GFP chimeric protein is localized diffusely throughout the cytosol of most cells, but with some enrichment in the nucleus.

• Primary Identifier: Expr9722
• Pattern: Expression becomes detectable around the comma stage of embryogenesis and persists through adulthood. Expression in vulval precursor cells is strong and can first be seen in L3. PQN-47::GFP is expressed in seam cells, peaking at L2 and ceasing after the seam cells differentiate in late L4, concurrent with the appearance of alae. The intestine shows variably undetectable to low pqn-47 expression (always less than in the neurons) and gets dimmer as development progresses, especially after L3. The two bulbs of the pharynx, specifically pharyngeal muscle cells pm3-8 (not pm6), are variably bright. Overall expression levels are lower in adults than younger animals, with only some expression in head and tail neurons remaining. Head and nerve ring neurons, pharyngeal cells, ventral nerve cord cells, vulval precursor cells, seam (though interestingly not hyp7), as well as cells in the tail show the strongest pqn-47 expression. Muscle, intestine, the distal tip cells of the gonad, the spermatheca, and a large neuron that may be CAN that is essential for survival but of unknown function near the vulva (also bathed in pseudocoelom fluid, and next to the seam and canal cells), as well as a subset of the ciliated neurons of the head (amphid neurons ASI, ADL, ASK, or AWB) and tail including phasmid cilia PHA and PHB, also express pqn-47. We could not detect expression in the pharyngeal glands as reported for a different promoter pqn-47 fusion construct made as part of a high-throughput analysis of gene expression, although other tissues did show similar patterns. Promoter and translational reporters show pqn-47 expression in numerous somatic cells, including cells uniquely poised to mediate or transmit signal(s) involved in the regulation of molting, some of which have been implicated in molting. For example, many cells expressing PQN-47 have significant exposure to the pseudocoelom, and as such are candidates to transmit or detect endocrine signals; the H-shaped excretory cell and its ducts, which form extensive gap junctions with the hypodermis and lie against the pseudocoelom along the entire body of the worm (Nelson and Riddle, 1984), the head mesodermal cell (hmc) lies in the pseudocoelom up against the (excretory) gland cell and forms gap junctions with them and muscle, and the VPI cells at the juncture of the pharynx and intestine are bathed by the pseudocoelom, as well as the intestine itself.

• Primary Identifier: Expr9255
• Pattern: miR-52 GFP reporter was expressed most widely in hypodermal, muscle, neural, and interstitial cell types in both embryos and larvae. mir-52 was most strongly expressed in the pharynx and anterior embryo but was detectable in most other tissues.

• Primary Identifier: Expr9256
• Pattern: miR-53 GFP reporter was expressed most widely in hypodermal, muscle, neural, and interstitial cell types in both embryos and larvae. mir-53 was more strongly expressed in the hypodermis and neurons and more weakly expressed in the gut and anterior cells around the pharynx.

• Primary Identifier: Expr9952
• Pattern: CCDC- 55::GFP is broadly expressed in larvae and adults. The ccdc-55 message is transcribed as part of a multi-gene operon, CEOP3156, with the predicted promoter 5' of rnf-121. It is likely the expression pattern seen in the rnf-121::GFP animals is relevant for ccdc-55, this includes muscle, seam, hypodermis, vulva and somatic gonad with prominent expression in the DTC. In C. elegans, genes contained in operons can also be expressed independently (Blumenthal and Gleason, 2003), so the rnf- 121-based expression pattern may not completely recapitulate the endogenous expression of ccdc-55.
• Subcellular Localization: Animals expressing a CCDC-55::GFP fusion protein in the DTC under the control of the lag-2 promoter were generated. In these animals, it was observed a nuclear and cytoplasmic distribution of CCDC-55::GFP in the DTC. However, the CCDC-55 localization was predominantly nuclear.

• Primary Identifier: Expr9978
• Pattern: svh-2::els::venus. Expression of the svh-2 gene was detected in muscles, intestine, excretory canals, distal tip cells and some neurons, but not in D-type motor neurons.

• Primary Identifier: Expr14677
• Subcellular Localization: Functional, endogenously tagged isoforms A-C of a-catenin (HMP-1::GFP; n = 19/19) and b-catenin (GFP::HMP-2; n = 11/11), which associate with E-cadherin, were also expressed in the DTC and germ cells and localized to membrane contact sites. HMP-1::GFP only tags half of the HMP-1 isoforms, which may make it more difficult to see. However, single confocal slices clearly show that it is present in the DTC, muscle, and germline.

• Primary Identifier: Expr15129

• Primary Identifier: Expr15132

• Primary Identifier: Expr15133

• Primary Identifier: Expr9333
• Pattern: GFP expression driven by vps-52 promoter is visible in all cell types: pharyngeal, intestine, distal tip cell, coelomocytes, body wall muscles, and neurons.

• Primary Identifier: Expr9442
• Remark: Operon: CEOP5440
• Pattern: A-class motor neuron: enriched in embryo (2.9); not expressed in larva. Neuronal expression include: Weak in head and tail neurons, ventral cord. Also expressed in other cells: Pharynx, sheath cells, distal tip cell. Pan-neuronal: enriched in embryo (1.9); expressed in larva.
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms

• Primary Identifier: Expr9532
• Remark: Operon: CEOP1360
• Reporter Gene: The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons. Larval Expression: intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; gonad sheath cells; body wall muscle; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Mitochondria

• Primary Identifier: Expr11704
• Pattern: Expression of the transcriptional fusion Ptop-1::gfp was not detected in early embryonic cells due to maternal germline silencing of the multi-copy transgenic gene. The GFP expression, however, was observed in most cells at the late embryonic stage and decreased with larval development. In the larval stages, GFP expression was predominantly present in the neuronal system, including sensory neurons (ILso, URX, RIC, IL1/IL2, AIY/AIM and RIG/RIF), motor neurons (VC4, VC5, HSN, PVD and PVM) of hermaphrodites and tail neurons (SPD and SPV/SPC) of males. The expression of the transcriptional fusion Ptop-1::gfp was strong in DTCs during the L3-L4 stage when gonad migration proceeds.

• Primary Identifier: Expr9731
• Pattern: The image provided is for UL2932, but this strain was lost. However, GFP expression of UL3471 looked identical to that of UL2932. The GFP expression pattern in both strains looked like that for UL3244, for which gfp had been inserted directly upstream of the vab-3 stop codon, but weaker. It wasn't clear if GFP expression in the distal tip cell was also present. UL3469 had a more restricted expression than UL2932 or UL3471, with GFP in mostly only one neuron in the head but this could be due to greater mosaicism for the extrachromosomal transgenic array in this strain.

• Primary Identifier: Expr9916
• Pattern: RAB-6.2::GFP is highly expressed in body wall muscles, pharyngeal and vulval muscles, hypodermis, intestine, the gonad, coelomocytes, seam cells, vulval epithelia, distal tip cells, ventral cord dendrites, and neurons. We also introduced this transgene into nematodes that also express a Pglr-1::monomeric RFP (mRFP) transgene (Shim et al., 2004), and we found that RAB-6.2::GFP is expressed in the GLR-1-expressing command interneurons.
• Subcellular Localization: RAB-6.2 is localized to punctate structures in the neuron cell body and along the ventral cord dendrites. We introduced the Pglr-1::cerulean:: rab-6.2 transgene into nematodes that express the Golgi resident protein mannosidase (MANS)::YFP (Rolls et al., 2002; Glodowski et al., 2005) and observed nearly complete colocalization between Cerulean::RAB-6.2 and MANS::YFP, indicating that RAB-6.2 is localized on or near Golgi structures.

• Primary Identifier: Expr10160
• Pattern: In larvae and adult hermaphrodites, the F40F11.2/mig-38 promoter-driven GFP signal is found mainly in neurons, muscles, and other contractile tissues such as the spermatheca (Hunt-Newbury et al., 2007). mig-38 expression was additionally detected in the somatic gonad precursors, Z1 and Z4 and later within DTCs during larval and adult stages. Gonadal dissections allowed detection of F40F11.2p::GFP expression within the gonadal sheath cells. However, expression was not observed in the germ cells or their precursors Z2 and Z3.
• Subcellular Localization: YFP::MIG-38 is expressed in the cytoplasm of body wall muscle cells. YFP::MIG-38 also appeared to be localized in muscle cell nuclei.

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
a cellular object that consists of subcellular components, expresses genes or functions.	Cell	Cell type	WBbt:0004017
organ producing either sperm or ova.	gonad		WBbt:0005175