6 Children
| Definition | Name | Synonym | Primary Identifier |
|---|---|---|---|
| epithelium connecting intestine and anus. | rectal epithelium | WBbt:0005800 | |
| cylindrical hypodermal syncytium in the head, including hyp1-hyp6 | anterior hypodermis | head hypodermis | WBbt:0005373 |
| primary cell type that forms the hypodermis. | hypodermal cell | WBbt:0007846 | |
| hypodermis making up the tail. | tail hypodermis | WBbt:0006978 | |
| hypodermis of the male hook. | hook hypodermis | hyp_hook | WBbt:0006906 |
| cloacal epithelium | WBbt:0005808 |
20 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_L3-L4-larva_expressed | |
| Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_larva_enriched | |
| Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_larva_SelectivelyEnriched | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_L1-larva_expressed | |
| Proteins expressed in epidermis cytoplasm, according to tissue specific APX enzyme expression using dpy-7 promoter driven NES(cytoplasm)-GFP-APX, followed with mass spectrometry. | Fold change > 2. | WBPaper00051245:epidermis_cytoplasm_expressed | |
| Proteins expressed in epidermis nucleus, according to tissue specific APX enzyme expression using dpy-7 promoter driven NLS(nucleus)-GFP-APX, followed with mass spectrometry. | Fold change > 2. | WBPaper00051245:epidermis_nucleus_expressed | |
| Proteins specifically expressed in epidermis, according to tissue specific APX enzyme expression using dpy-7 promoter, followed with mass spectrometry. | Fold change > 2. | WBPaper00051245:epidermis_specific | |
| Single-cell RNA-Seq cell group 33_0 expressed in hypodermis. | scVI 0.6.0 | WBPaper00065841:33_0 | |
| Transcripts uniquely expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_enriched | |
| Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_embryo_enriched | |
| Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_embryo_SelectivelyEnriched | |
| Single-cell RNA-Seq cell group 30_1 expressed in hypodermis. | scVI 0.6.0 | WBPaper00065841:30_1 | |
| Single-cell RNA-Seq cell group 30_2 expressed in hypodermis. | scVI 0.6.0 | WBPaper00065841:30_2 | |
| Top 300 transcripts enriched in hypodermis according to single cell RNAseq. | Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. | WBPaper00061340:Hypodermis | |
| Single-cell RNA-Seq cell group 2_0 expressed in hypodermis. | scVI 0.6.0 | WBPaper00065841:2_0 | |
| Single-cell RNA-Seq cell group 82_0 with unidentified tissue expression pattern. | scVI 0.6.0 | WBPaper00065841:82_0 | |
| Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:hypodermis_CoreEnriched | |
| Micro RNAs that showed significantly decreased expression in day 8 adults comparing to in day 1 adults in hypodermis. | Differentially expressed miRNAs were identified using DEGseq based on unique molecular identifier (UMI). A minimum UMI sum of 10 in 3 replicates was set as the threshold of expression. MiRNAs with more than five reads were defined as expressed. Differential expression of miRNAs was analysed by t-test (P value < 0.05 and fold-change > 1.5 or < 0.67) after Box-Cox transformation. MiRNA targets were identified by TargetScanWorm (Release 6.2) and Pearson Correlation Coefficient smaller than -0.2. | WBPaper00066447:Day8_vs_Day1_downregulated_hypodermis | |
| Micro RNAs that showed significantly increased expression in day 8 adults comparing to in day 1 adults in hypodermis. | Differentially expressed miRNAs were identified using DEGseq based on unique molecular identifier (UMI). A minimum UMI sum of 10 in 3 replicates was set as the threshold of expression. MiRNAs with more than five reads were defined as expressed. Differential expression of miRNAs was analysed by t-test (P value < 0.05 and fold-change > 1.5 or < 0.67) after Box-Cox transformation. MiRNA targets were identified by TargetScanWorm (Release 6.2) and Pearson Correlation Coefficient smaller than -0.2. | WBPaper00066447:Day8_vs_Day1_upregulated_hypodermis |
1735 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Picture: Figure S4F. | Expr4895 | EVA-1::GFP expression was observed along the VNC, body wall muscles, Also expressed in pharyngeal muscles and hypodermis. | Exclusively localized on or near the cell surface membrane. | |
| Expr4863 | A-class motor neuron: enriched in embryo (3.0) and larva (2.8). Neuronal expression include: Bright in anterior ventral cord neurons, weak and mosaic in posterior ventral cord. Also expressed in other cells: Pharyngeal/intestinal valves, hypodermis. Pan-neuronal: expressed in embryo; enriched in larva (1.8). | |||
| Expr4868 | A-class motor neuron: enriched in embryo (5.1) and larva (1.7). Neuronal expression include: DA, DB, VA, VB, VD. Also expressed in other cells: Intestine, hypodermis. Pan-neuronal: enriched in embryo (1.9) and larva (2.7). | |||
| Expr4841 | A-class motor neuron: expressed in embryo; not expressed in larva. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, PLN. Also expressed in other cells: Pharyngeal muscle, vulval muscle, anal depressor, hypodermis. Pan-neuronal: enriched in embryo (1.8); not expressed in larva. | |||
| Expr4843 | A-class motor neuron: expressed in larva; enriched in embryo (2.0). Neuronal expression include: Bright in head neurons, few tail neurons. weak in all ventral cord motor neurons. Touch neurons, PDE. Also expressed in other cells: Intestine, head muscle, pharyngeal muscle, hypodermis, distal tip cell. Pan-neuronal: expressed in larva; enriched in embryo(3.0). | |||
| Picture: Figure 1D, I and II. | Expr4833 | The promoter extracted from B0336.3 is able to drive GFP expression in hypodermis, pharyngeal gland cell, gut, and nerve ring. | ||
| Picture: Fig. 10, C. | Expr4822 | The hex-2::gfp construct appeared to be active in the hypodermal cells, vulval toroids, and various adult head and tail neurons, Expressed throughout the life-cycle. | ||
| Expr4687 | Embryonic expression of pgp-2::gfp was first seen in the daughters of the E blastomere (E2 stage), which generate the intestine. Intestinal expression persisted through embryogenesis and into adulthood. Rarely, weak expression of pgp-2::gfp was detected in embryonic and adult hypodermal cells. Pharyngeal or AWA expression of the pgp-2::gfp reporter were never detected. | |||
| Expr4793 | For all arrays examined, the reporter gene was expressed exclusively in hypodermal cells. In males, expression of dpy-5::gfp generally resembles that of hermaphrodites. Fluorescence is observed within the head and tail hypodermal cells, the P cells and hyp7, and is absent or of low abundance within the seam cells. This is more easily seen in a higher magnification of the tail region in which GFP is notably absent in the V5-derived seam cell, yet abundant in its sister set cell and the V6- and T-derived specialized hypodermal cells that envelope the sensory rays used in copulation. In summary, expression of the dpy-5::gfp reporter gene in the hypodermal cells begins in L1, and continues throughout larval development, ending in adulthood. In seam cells, expression is variable, suggesting that it may be regulated differently than in the hypodermal cells. | |||
| Expr4787 | glt-1 is strongly expressed in body wall muscles from early developmental stages. Early in development glt-1 expression was seen in hypodermal cells. Towards adulthood, the GLT-1::GFP signal becomes more restricted to the head muscles. | In head muscles, bright GFP punctae seem to project from the cell soma towards the center of the nematode head | ||
| Expr4783 | Prominent expression of ORAI-1::GFP was detected in the spermatheca, intestine and hypodermis. In the intact animal, it was unclear whether gonadal sheath cells expressed ORAI-1::GFP, due to the intense fluorescence from the intestine and spermatheca. To examine sheath cell expression further, authors imaged gonads dissected free from a worm strain expressing an orai-1 transcriptional GFP reporter. orai-1 is also expressed in both proximal and distal gonadal sheath cells. | Intestinal expression appeared to be localized to both apical and basolateral membrane regions. The circumferential ORAI-1::GFP localization pattern is consistent with expression in the basal plasma membrane. Non-circumferential localization is probably due to membrane folding and/or expression at lateral cell borders. The complicated morphology of the spermatheca precluded definitive localization of ORAI-1::GFP to the apical cell membrane. | ||
| Expr4779 | The fkb-6 transcript was temporally expressed in all stages from embryo to adult with predominant spatial expression being noted in the adult dorsal and ventral nerve cords. In addition, weaker spatial expression was noted in the pharynx, hypodermis, body wall muscle cells and some somatic and gut cells. | |||
| Expr4772 | Expressed in excretory cell, muscle, hypodermis. | |||
| Expr4767 | Young embryos did not present a GFP signal, but expression was observed in late embryogenesis and at all stages of postnatal development: eggs, L1, L2, L3, L4, and adults. Adult animals showed stronger expression than did larval stages and eggs; this was also proved by RT-polymerase chain reaction (RT-PCR), suggesting potential developmental dynamics in atx-3 function. Both transgenic strains had a generalized expression pattern, with a strong signal in the spermatheca and vulval muscle . High fluorescence was observed in neuronal dorsal and ventral cord and neurons of the head and tail. Expression was also observed in the hypoderm, body muscles, and coelomocytes. | |||
| Expr4768 | vps-45::EGFP is ubiquitously expressed in all major tissues, such as neuron, muscle, hypodermis and intestine. vps-45::EGFP is also expressed in coelomocytes. | |||
| Picture: Figure 5B. | Expr4986 | Consistent with the ubiquitous expression of sqt-3 throughout the life cycle, the R584 antiserum intensely stains the hypodermal cells and cuticles of all stages. Reactive antigens are first detected in wild-type comma-stage embryos within the hypodermal cells. The signal localizes perinuclearly, presumably in association with the secretory pathway. At the threefold stage, coincident with cuticle secretion, the signal becomes progressively extracellular: by the late pretzel stage, all antigen is detected in alignment with the annular ridges of the embryonic cuticle. | ||
| Picture: Fig. 4D, 4E. | Expr4981 | BRO-1 and RNT-1 are co-expressed in seam and muscle cells, and BRO-1 is additionally expressed in hypodermal nuclei, certain pharyngeal neurons and the utse. | Co-localisation is shown using rescuing bro-1::DsRed (pAW303) and rnt-1::GFP (pAW260) constructs. Faint BRO-1::RFP and RNT-1::GFP co-localisation is also observed in certain body wall muscle cells. BRO-1::RFP, but not RNT-1::GFP, was observed in certain pharyngeal neurons. | |
| Picture: Figure 4a-i. | Expr4983 | High levels of constitutive GFP expression was observed in the pre-anal, vulval, hypodermal, glial amphid socket and excretory duct cells of the adult animal. | ||
| Picture: Figures 2A and 2B. | Expr4953 | LIN-44 is secreted by four hypodermal cells in the tail throughout embryonic and larval development. | ||
| Picture: Fig. 5, Fig 6. | Expr4956 | NAB-1::GFP expression is restricted to epithelia and neurons. The earliest expression was observed in the hypodermis of 2-fold-stage early embryos. Immediately prior to hatching, this expression became restricted to the epithelial excretory canal and the nervous system, including the central nervous system and the motoneurons (dorsal and ventral nerve cords. In L3 and L4 larvae, NAB-1::GFP also localized transiently at the membranes of the developing vulva epithelia. Also expressed in distal tip cell (pers. comm. from Wesley Hung 11-17-07.) | NAB-1::GFP puncta partially co-localized with the synaptic-vesicle protein SNT-1 and the active-zone protein UNC-10, suggesting that NAB-1 is present in presynaptic regions that are associated with vesicle pools and active zones. Similar to NAB-1, SAD-1 also showed co-localization with SNT-1. NAB-1::GFP and SAD-1 also showed partial co-localization, where each NAB-1::GFP punctum was associated with SAD-1 staining. | |
| Picture: Fig S5. | Expr4911 | A transcriptional fusion of the unc-50 promoter to GFP is expressed in all cell types throughout development. unc-50::gfp expression was seen in the head of adult hermaphrodite. Expression is seen in the pharyngeal muscle, head neurons, and epidermis. Expression is also present in the gut, ventral cord motor neurons, and epidermal seam cells. In the mid body region expression is seen in the gut, seam cells, uterus, vulva muscles, and distal tip cell. In the tail region unc-50 expression can be detected in the epidermis and enteric muscles. | ||
| Picture: Fig 5. | Expr4908 | MML-1::GFP was observed in epidermal cells as early as the 50 to 100 cell stage of embryogenesis and in intestinal cells at the 4E stage. Expression persisted in these two cell types through all larval stages and adulthood. | Nuclear at all stages. | |
| Expr4909 | MXL-2::GFP was expressed in epidermal and intestinal cells. | Nuclear at all stages. | ||
| Expr4393 | The GFP signal was first detected from the 3-fold stage of embryogenesis during development. At the 3-fold stage, GFP expression was observed in hypodermal and intestinal tissues. During larval and adult stages, GFP was strongly detected in the hypodermis and intestine as well as the excretory cells. | |||
| To test the tissue specificity of the expression of Caenorhabditis mannosidase II, a promoter gfp reporter construct was designed to generate a translational fusion. To select easily for the low copy number transformants carrying the aman-2::gfp reporter fusion, the 2000 bp upstream of the aman-2 gene were ligated into a vector carrying not only a gfp sequence but also the unc-119 gene and stably integrated into unc-119 (ed3) mutants. Two independent low copy number transgenic lines were generated and analyzed. The reporter plasmid used was a form of the pPD95.67 (L2459) promoterless gfp vector3. This vector was then modified by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. Then, a genomic fragment corresponding to the 2000 bp upstream of the aman-2 gene was isolated by PCR using the primers ManII_prom/1/XbaI gctctagacggacgagaagtacaaat and ManII_prom/2/XbaI gctctagacccatgctttatcttgccat. Both the fragment and the pPD95.67/unc-119 vector were cut with XbaI and ligated. A selected clone was sequenced and verified to contain the expected aman-2 upstream region and was used to transform unc-119 (ed3) mutants with a particle gun. --precise ends. | Expr4390 | Confocal microscopy indicated that the aman-2 promoter is most active in the gut wall, pharynx and grinder, hypodermal cells, and cells of the nervous system (ventral nerve cord cells, neurons surrounding the pharyngeal bulb and in the head) in adult animals; also rather ubiquitous expression was seen in larvae. | ||
| No detailed description on life stages. | Expr4379 | ZK795.3::GFP expression pattern includes spermatheca, hypodermal cells, pharynx and the excretory cell and channels. In the L3 stage, expression was seen in the vulva, and in P6.p descendants. | ||
| No detailed description on cellular expression patterns. | Expr4343 | WIP-1 was expressed broadly among many cell types during embryogenesis. In addition, WIP-1 was detected in hypodermal cells in the ventral enclosure. Staining by anti-WIP-1 antibody was reduced in wip-1(RNAi)-treated embryos. | ||
| Expr4438 | Expressed in the hypodermis in larval and adult stages. Expressed in the seam cells at adult stage. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. | |||
| Expr4428 | Expressed in the hypodermis from embryo stage through adulthood. | |||
| Expr4429 | Expressed in the hypodermis from embryo stage through adulthood. Expressed in the seam cells from embryo through adult. Expressed in the rectal epithelial cells from L1 and maintained through adulthood. Expressed in anterior and posterior arcades. Expressed in the excretory duct and pore cells. |
5 Life Stages
| Remark | Definition | Other Name | Public Name | Primary Identifier |
|---|---|---|---|---|
| The second stage larva. At 25 Centigrade, it ranges 25.5-32.5 hours after fertilization, 11.5-18.5 hours after hatch. | L2 larva Ce | WBls:0000027 | ||
| The first stage larva. At 25 Centigrade, it ranges 14-25.5 hours after fertilization, 0-11.5 hours after hatch. | L1 larva Ce | WBls:0000024 | ||
| The stage that begins when a C.elegans individual is fully-developed and has reached maturity. | adult Ce | WBls:0000041 | ||
| The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching. | embryo Ce | WBls:0000003 | ||
| A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. | larva Ce | WBls:0000023 |
2 Parents
| Definition | Name | Synonym | Primary Identifier |
|---|---|---|---|
| Association of cells with a common embryological origin or pathway and similar structure and function. Usually, cells of a tissue are contiguous at cell membranes and may be of one or more types. Tissues aggregate to form organs. | Tissue | WBbt:0005729 | |
| lies within the body wall, in close relation to nervous system and excretory system. | epithelial system | WBbt:0005730 |
