WormMine: AnatomyTerm WBbt:0005735

• Definition: Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.
• Name: nervous system
• Primary Identifier: WBbt:0005735

5 Children

Definition	Name	Synonym	Primary Identifier
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
cells that support sensory neurons, similar to glial cells in vertebrates. A category which collectively refers to socket cells, sheath cells, and structural cells, or their processes. All of these cells extend long processes which serve a supporting role, rather like glia, to form a protective environment around sensory neuron endings. In addition, some of these cells extend broad thin processes from their somata which wrap around neuronal ganglia, again in a glia-like fashion	accessory cell	support cell	WBbt:0005762
The pharyngeal nervous system is composed of 20 pharyngeal neurons which lie completely within the pharynx.	pharyngeal nervous system		WBbt:0005440
A cluster of nerve cells and associated glial cells (nuclear location).	ganglion		WBbt:0005189
Part of the nervous system that lies completely outside the pharynx.	somatic nervous system		WBbt:0005760

0 Expression Clusters

1591 Expression Patterns

• Primary Identifier: Expr4885
• Remark: Picture: FIG. 1D-G.
• Pattern: Expressed in a relatively broad range of tissues. Robustly expressed in vulval muscles, and modestly expressed in body wall muscles and in the pharynx. Expression of was also observed in the intestine and expression of asd-1 was observed in the nervous system. Widely expressed in the early embryos before morphogenesis.

• Primary Identifier: Expr4829
• Remark: Picture: Fig. 6A, 6B. Reporter gene fusion type not specified.
• Pattern: Exclusively expressed throughout the nervous system in C. elegans. F25B3.3::gfp is a postmitotic pan-neuronal marker, i.e. its onset of expression is observed after the terminal division of neurons (around 450 minutes of embryonic development).

• Primary Identifier: Expr4951
• Remark: Picture: Figure 2.
• Pattern: GLO-4::GFP showed a discrete punctate localization in many different tissues, including muscle, pharynx, gut, and nervous system.

• Primary Identifier: Expr4241
• Remark: The large amounts of flanking DNA in the recombineered fusions may avoid artifactual expression potentially arising from fusions with incomplete promoters. The more tightly localized distribution of the fluorescent proteins may be because the product of the X-gal staining reaction, used to visualize -galactosidase, spreads from the source. However, the recombineered fusions result in the fluorescent tag being added to the terminus of a virtually intact C.elegans protein, and the fusion protein may then show a subcellular distribution more tightly reflecting the distribution of the endogenous protein.
• Pattern: GFP and CFP expression patterns observed for F40E10.6 reporter fusions generated by fosmid recombineering were strong and clear, restricted to the nervous system, from the circumpharyngeal nerve ring in the head, down the nerve cord, around the vulva, to the tail ganglia. No expression could be detected in the pharynx.

• Primary Identifier: Expr5296
• Remark: Strain: BC10524
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5297
• Remark: Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5298
• Remark: Strain: BC10900
• Reporter Gene: [C18A3.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTCGTTCATAATGCTGCG] 3' and primer B 5' [TGAAGAAGGAGATGGCTTAAATG] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; Larval Expression: pharynx; intestine; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5291
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173
• Reporter Gene: [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5292
• Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998
• Reporter Gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5294
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15588
• Reporter Gene: [C17H12.13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCAAACAATTCCAGCAAATTA] 3' and primer B 5' [TTCGCAGTGATATCTGGAAAATTA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5285
• Remark: Also expressed in (comments from author) : Head neurons are mechanosensory, possibly the CEP sensilla. Strain: BC10478
• Reporter Gene: [C17E4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGACTAGGCGACGATGA] 3' and primer B 5' [TTATCGCTGATAATGTGAACGAGT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; tail neurons; unidentified cells; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons

• Primary Identifier: Expr5286
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16202
• Reporter Gene: [srz-67::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGCAGTTACTGTCCCCTTA] 3' and primer B 5' [AGCAATTGATTTCAAACTCGC] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons

• Primary Identifier: Expr5288
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11855
• Reporter Gene: [C17G10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTTCCCTAGAAGCATTGGC] 3' and primer B 5' [TCTTCCAGATAAAAACCATCGG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr5289
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10522
• Reporter Gene: [C17G10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCGACTCGAGGAACTGT] 3' and primer B 5' [CTGGGGAAGATCGATTGGT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons

• Primary Identifier: Expr5280
• Remark: Strain: BC10891
• Reporter Gene: [C16C10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGCAGATTTTTGGAATTTTCAC] 3' and primer B 5' [GCCGTTTTGATGCGATCT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr5281
• Remark: Also expressed in (comments from author) : Notes have been lost. 2 images taken and posted, appears neural. Strain: BC10763
• Reporter Gene: [ceh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAGTATCCTCTGCATCGGT] 3' and primer B 5' [GTATCGGCAGAAGGGATAGTTG] 3'.
• Pattern: Larval Expression: Nervous System; nerve ring; head neurons

• Primary Identifier: Expr5283
• Remark: Strain: BC13820
• Reporter Gene: [rol-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAAACTCGTTCCATCATT] 3' and primer B 5' [GTCGTCATGTACAGGCTGTCT] 3'.
• Pattern: Adult Expression: hypodermis; Nervous System; head neurons; Larval Expression: hypodermis; Nervous System; head neurons

• Primary Identifier: Expr5273
• Remark: Strain: BC10379
• Reporter Gene: [C16A3.10a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCTTTTGGTTGCAATTT] 3' and primer B 5' [GAGGGAGGACAAGATTCTGC] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5276
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14096
• Reporter Gene: [C16C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; amphids; unidentified cells in tail

• Primary Identifier: Expr5277
• Remark: Strain: BC15643
• Reporter Gene: [tag-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; amphids; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; seam cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5278
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14394
• Reporter Gene: [C16C10.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTGCAATCGTGGTAGGATTT] 3' and primer B 5' [CCGACGAACGATTTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5279
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14128
• Reporter Gene: [C16C10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGCCATATTGGTAGCTGTGG] 3' and primer B 5' [GACCGTTGCTGATTTTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5271
• Remark: Strain: BC10466
• Reporter Gene: [nnt-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCCCTCATTGATTGTGATCT] 3' and primer B 5' [CGAAGAATGACGATGCTGAA] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5272
• Remark: Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066
• Reporter Gene: [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5262
• Remark: Also expressed in (comments from author) : Head neurons are possibly the ring interneurons (RIF and RIG) Strain: BC12233
• Reporter Gene: [ceh-16::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATACCACAAGTTTTTGGCCG] 3' and primer B 5' [CTAAGGAAGCTCCGCCTCTT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: seam cells; Nervous System; head neurons

• Primary Identifier: Expr5263
• Remark: Also expressed in (comments from author) : low intensity GFP in unidentified cells. Strain: BC12234
• Reporter Gene: [ceh-16::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATACCACAAGTTTTTGGCCG] 3' and primer B 5' [CTAAGGAAGCTCCGCCTCTT] 3'.
• Pattern: Adult Expression: seam cells; Nervous System; head neurons; unidentified cells in head; Larval Expression: seam cells; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5267
• Remark: Strain: BC12527
• Reporter Gene: [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; head neurons; unidentified cells in head; Larval Expression: pharynx; intestine; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr5268
• Remark: Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. Strain: BC10468
• Reporter Gene: [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'.
• Pattern: Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head

• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
intergrated group of organs, performing one or more unified functions.	Organ system		WBbt:0005746