WormMine: AnatomyTerm WBbt:0004070

• Definition: Neuron class of one interneuron, projects along ventral cord to ring.
• Name: PVT
• Primary Identifier: WBbt:0004070
• Synonym: lineage name: ABplpappppa

1 Children

Definition	Name	Synonym	Primary Identifier
nucleus of pedigree ABplpappppa	ABplpappppa nucleus		WBbt:0002635

4 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in PVT according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:PVT
	Single-cell RNA-Seq cell group 138_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:138_0
	Transcripts enriched in PVT according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:PVT_enriched
	Single-cell RNA-Seq cell group 168 expressed in: PVT.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:168

191 Expression Patterns

• Primary Identifier: Expr4871
• Remark: Picture: 6B, 6C.
• Pattern: GFP expression was observed in PVT. GFP was also detected in the uterine cells close to vulva.

• Primary Identifier: Expr4684
• Pattern: GFP expression was detected at most developmental stages, with the spatial expression depending on the developmental stage of the animal. Neuronal expression of hlh-29 was detected in larvae and adults in both amphid and phasmid sockets, in the ALA and PVT neurons, in the chemosensory and mechanosensory neurons, ASI, ASK, PHA, and PQR, and in neurons of the anterior pharyngeal bulb. Weaker expression was also detected in the ASG chemosensory neurons in some transgenic lines. L1 animals show strong expression of hlh-29 in intestinal cells, and weaker expression in the rectal glands and the pharyngeal muscle cell PM1. By L3 stage, intestinal expression of the hlh-29::GFP is limited to the posterior intestinal cells, and PM1 expression is no longer detected. Expression is also detected in the ventral posterior coelomocytes in the later L3-stage larvae, and in the spermatheca and vulval muscles of L4 and adult animals.

• Primary Identifier: Expr4244
• Pattern: ser-1::gfp expression was observed in the pharyngeal muscles. In addition, ser-1::gfp expression was observed in the vulval muscles, as well as in many neurons. ser-1::gfp is not detectable in HSN or VC.

• Primary Identifier: Expr4445
• Pattern: Expressed in socket cells of IL or OLQ. Expressed in the PVT cell.

• Primary Identifier: Expr4532
• Remark: "ASEL biased" incorporates two categories of expression patterns in a given transgenic line: expression only in ASEL in some animals and stronger expression in ASEL than in ASER in other animals.
• Pattern: ASEL biased, AWCL/R (faint), PVT.

• Primary Identifier: Expr4525
• Pattern: Expressed in ASER, ASIL/R, PVT, URXL/R, AIYL/R, intestine.

• Primary Identifier: Expr4526
• Pattern: Expressed in AWAL/R, ASIL/R, RIAL/R, PVT.

• Primary Identifier: Expr4527
• Pattern: Expressed in ASER, ASIL/R, PVT.

• Primary Identifier: Expr5245
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14645
• Reporter Gene: [sre-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGGCAATGATGTTTTGC] 3' and primer B 5' [TTTTGTTTGAACCGATTTTTGA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; PVT interneuron; Larval Expression: intestine; Nervous System; head neurons; PVT interneuron

• Primary Identifier: Expr5438
• Remark: Strain: BC11960
• Reporter Gene: [ced-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGGCCTCTCACATTCCTGT] 3' and primer B 5' [TGATGTTTTCGAAACAACGGT] 3'.
• Pattern: Adult Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; Larval Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons

• Primary Identifier: Expr5431
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail, neural. Strain: BC12994
• Reporter Gene: [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'.
• Pattern: Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5433
• Remark: Strain: BC12382
• Reporter Gene: [C35D10.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCGTTTGAGCACGCA] 3' and primer B 5' [CCGAACTTATGCTGATACTGTTT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; PVT interneuron; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; PVT interneuron

• Primary Identifier: Expr5657
• Remark: Also expressed in (comments from author) : Embryo incomplete. Strain: BC13252
• Reporter Gene: [let-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGATATGAACGGTGGAATTT] 3' and primer B 5' [TCGTTGCTTCATGGTGGTAG] 3'.
• Pattern: Adult Expression: anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; PVT interneuron; tail neurons; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; head neurons; PVT interneuron; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5567
• Remark: Also expressed in (comments from author) : Mosaic population Strain: BC15999
• Reporter Gene: [srsx-30::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGAAAAACTCAAACCTCAAAA] 3' and primer B 5' [CCAAAGATTTCCTGAAAACAACA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons; unidentified cells in head; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons; unidentified cells in head

• Primary Identifier: Expr6541
• Remark: Strain: BC12845
• Reporter Gene: [R144.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCTTTTTCCTGCTTCCA] 3' and primer B 5' [TTAAAATTACCCCGAAATAAACGA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; neurons along body; PVT interneuron; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; neurons along body; PVT interneuron

• Primary Identifier: Expr6445
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15614
• Reporter Gene: [R02E12.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACCCAAGGTGCAAAGGTTC] 3' and primer B 5' [ACGGTGATCCTTAAAGTTGGATT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons

• Primary Identifier: Expr6415
• Remark: Strain: BC10671
• Reporter Gene: [M03F4.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCACAAGGGACCGTTTTT] 3' and primer B 5' [TTCAACCCACGATAAGAAAATTG] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; tail neurons

• Primary Identifier: Expr6667
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14933
• Reporter Gene: [scd-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTAGATAGGTAGGCATTTTGCGT] 3' and primer B 5' [CTTCGTTTACGGATCTTACTGGTT] 3'.
• Pattern: Adult Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; PVT interneuron; tail neurons; phasmids; Larval Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; PVT interneuron; tail neurons; phasmids

• Primary Identifier: Expr6706
• Remark: Strain: BC15234
• Reporter Gene: [grd-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGGCACATATCCGTCGAT] 3' and primer B 5' [CGTGATCCGAATTGTGACTG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: Nervous System; head neurons; PVT interneuron; tail neurons

• Primary Identifier: Expr6177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11202
• Reporter Gene: [alh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCGAAGTGGATTTTGTTCT] 3' and primer B 5' [GAGAGCTGAACGGAGGATTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; neurons along body; PVT interneuron; Embryo Expression: intestine; Larval Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; neurons along body; PVT interneuron

• Primary Identifier: Expr6373
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14926
• Reporter Gene: [cyp-14A3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTTTATGTTGTCACGTTTTGTC] 3' and primer B 5' [GATTGTGAAACAGCCTTTGTTTT] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; PVT interneuron; tail neurons

• Primary Identifier: Expr6331
• Remark: Strain: BC14760
• Reporter Gene: [srz-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACCGACACCTTACGAGCAT] 3' and primer B 5' [TGTGGAATGTTTATGAGCTTTGA] 3'.
• Pattern: Adult Expression: hypodermis; Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: intestine; hypodermis; Nervous System; head neurons; PVT interneuron; tail neurons

• Primary Identifier: Expr6300
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15354
• Reporter Gene: [JC8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCGCCATATATATCTGAATTA] 3' and primer B 5' [TAATATGTGTAGTTTCGCGTGTCA] 3'.
• Pattern: Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; PVT interneuron

• Primary Identifier: Expr6243
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14699
• Reporter Gene: [sre-30::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTGGCAGAGTCGTGGATTTA] 3' and primer B 5' [TGTGGTCAACATTCAGACAAGA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: intestine; Nervous System; head neurons; PVT interneuron; tail neurons

• Primary Identifier: Marker43
• Remark: Picture: N.A. Reporter gene fusion type not specified.
• Pattern: PVT cell fate marker.

• Primary Identifier: Marker44
• Remark: Picture: N.A. Reporter gene fusion type not specified.
• Pattern: PVT cell fate marker.

• Primary Identifier: Marker45
• Remark: Picture: N.A.
• Pattern: PVT cell fate marker.

• Primary Identifier: Marker46
• Remark: Picture: N.A.
• Pattern: PVT cell fate marker.

• Primary Identifier: Expr14199
• Pattern: ASH, ASI, AWB (dimmer and less consistent), sometimes you see other neurons in the head (variable), PVT

• Primary Identifier: Expr6960
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14744
• Reporter Gene: [srab-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAACGAAACTATTAAAACCGCTC] 3' and primer B 5' [TGAAAAGATTTTTGAAATAAGCAA] 3'.
• Pattern: Larval Expression: intestine; Nervous System; head neurons; PVT interneuron; tail neurons

12 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	The C. elegans life stage spanning 620-800min(hatch) after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. A stage after elongation is over. The last stage of embryogenesis. Also called pre-hatched embryo, late embryo or morphogenetic embryo.		fully-elongated embryo Ce	WBls:0000021
	The C. elegans life stage spanning 350-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The stage that embryo starts elongation until elongation is over.		elongating embryo Ce	WBls:0000015
	The C. elegans life stage spanning 290-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage when embryo just finished gastrulation and is enclosing.		enclosing embryo Ce	WBls:0000013
	The C. elegans life stage spanning 100-290min after first cleavage at 20 Centigrade. Proliferate from 28 cells to 421 cells. Referring to the whole period of gastrulation.		gastrulating embryo Ce	WBls:0000010
	The C. elegans life stage spanning 0-350min after first cleavage at 20 Centigrade. Proliferate from 1 cell to 560 cells. From start of first cleavage until cleavage is over.		proliferating embryo Ce	WBls:0000004
	The C. elegans life stage spanning 520-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and tripple fold. A stage between 2-fold embryo and fully-elongated embryo. Also called pretzel embryo or pretzel stage.		3-fold embryo Ce	WBls:0000020
	The C. elegans life stage spanning 420-460min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and fold back 50%. A stage between comma embryo and 2-fold embryo.		1.5-fold embryo Ce	WBls:0000018
	The C. elegans life stage spanning 390-420min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo looks like a comma. A stage between bean embryo and 1.5-fold embryo.		comma embryo Ce	WBls:0000017
	The C. elegans life stage spanning 460-520min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and double fold. A stage between 1.5-fold embryo and 3-fold embryo.		2-fold embryo Ce	WBls:0000019
	The C. elegans life stage spanning 350-390min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. Emrbyo elongation started but have not formed comma shape yet. The shape of embryo looks like a lima bean. A stage right before comma embryo. Also called lima embryo or lima bean stage.		bean embryo Ce	WBls:0000016
	The C. elegans life stage spanning 210-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage before the fast cleavage of cells finishes.		late cleavage stage embryo Ce	WBls:0000014

4 Parents

Definition	Name	Synonym	Primary Identifier
	interneuron		WBbt:0005113
neuron with cell body in the preanal ganglion.	preanal ganglion neuron	preanal ganglion neurons	WBbt:0005447
neuron that has neural processes in the nerve ring.	nerve ring neuron		WBbt:0006974
embryonic cell	ABplpapppp		WBbt:0006019