WormMine: AnatomyTerm WBbt:0005439

• Definition: neuron of the pharyngeal nervous system.
• Name: pharyngeal neuron
• Primary Identifier: WBbt:0005439

5 Children

Definition	Name	Synonym	Primary Identifier
Neuron class of one pharyngeal motor neuron/interneuron.	MI neuron	lineage name: ABaraappaaa	WBbt:0003664
interneuron of the pharyngeal nervous system.	pharyngeal interneuron		WBbt:0003668
Neuron class of two marginal cell neuron of the pharynx.	MC neuron	marginal cell neuron	WBbt:0003638
	pharyngeal motor neuron		WBbt:0003677
Neuron class of two pharyngeal neurosecretory-motor neurons.	NSM	neurosecretory-motor neuron	WBbt:0003666

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in pharyngeal neuron according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Pharyngeal_neuron

188 Expression Patterns

• Primary Identifier: Expr4831
• Remark: Picture: Figure 1B, I and II.
• Pattern: The promoter extracted from C15C7.2 is able to drive GFP expression in the excretory cell, pharynx, pharyngeal neurons, and head neurons.

• Primary Identifier: Expr4821
• Remark: Picture: Fig. 10, A and B.
• Pattern: The hex-1 promoter was particularly active in coelomocytes as well as in neurons of the pharyngeal region and nerve cord, as compared with the head and tail pattern observed in strain BC14144 (see Expr6695). Expressed throughout the life-cycle.

• Primary Identifier: Expr4751
• Remark: Reporter gene fusion type not specified.
• Pattern: A functional olrn-1::GFP fusion gene was expressed in many pharyngeal neurons and some head neurons.

• Primary Identifier: Expr4981
• Remark: Picture: Fig. 4D, 4E.
• Pattern: BRO-1 and RNT-1 are co-expressed in seam and muscle cells, and BRO-1 is additionally expressed in hypodermal nuclei, certain pharyngeal neurons and the utse.
• Subcellular Localization: Co-localisation is shown using rescuing bro-1::DsRed (pAW303) and rnt-1::GFP (pAW260) constructs. Faint BRO-1::RFP and RNT-1::GFP co-localisation is also observed in certain body wall muscle cells. BRO-1::RFP, but not RNT-1::GFP, was observed in certain pharyngeal neurons.

• Primary Identifier: Expr4349
• Pattern: Transgenic animals carrying this construct show GFP fluorescence in a variety of cells, with robust expression in the pharyngeal muscle. GFP expression was also observed in many neurons, including specific subsets in the head, pharynx, ventral nerve cord and anal ganglia.

• Primary Identifier: Expr4431
• Pattern: Expressed in the seam cells at adult stage. Expressed in the rectal epithelial cells only in the fourth larval stage (L4). Expressed in VulB and VulD. Expressed in anterior arcade cells. Expressed in a pharyngeal neuron in the metacorpus extending a neurite anteriorly and an axon posteriorly.

• Primary Identifier: Expr4283
• Pattern: TBX-2::GFP expression was present in the both MS- and ABa-derived pharynx cells. TBX-2::GFP expression initiated at the 8E stage (staging by the number of endodermal, or E, cells), in 11 - 12 anteriorly localized pharyngeal cells. Based on position, these cells are likely to be the ABa descendants that will give rise to pharyngeal muscle cells (i.e., ABalpaaa a/p, ABalpapp a/p, ABaraaaaa, ABaraapa a/p, ABarapaa a/p, ARarapapp and ABaraapp a/p). By the 1.5-fold stage, TBX-2::GFP was expressed in pm3, pm5 and variably pm4, with expression persisting throughout the larval and adult stages. Surprisingly, expression extended beyond the ABa lineage after the 1.5-fold stage. For example, only 2/6 pm5 nuclei derive from ABa but authors often observed all pm5 cells expressing TBX-2::GFP in larvae. By the 3-fold stage authors also observed expression in pharyngeal neurons, occasionally in the posterior muscle pm8 and in cells outside of the pharynx such as body wall muscles. Thus, TBX-2::GFP expression initiated within the ABa lineage but ultimately appeared in both ABa and MS-derived muscle cells.
• Subcellular Localization: While TBX-2::GFP was initially localized to nuclei, it was detected in the cytoplasm as well as the nucleus in pm4 and pm5 cells by the 1.5-fold stage. Cytoplasmic expression was not homogeneous. Rather, TBX-2::GFP appeared filamentous, as though it was associated with the cytoskeleton. Cytoplasmic expression was observed even in lines expressing very low levels of TBX-2::GFP, suggesting that cytoplasmic TBX-2::GFP did not reflect over-expression from transgenes. The same pattern was observed in tbx-2(ok529); tbx-2::GFP embryos. This localization pattern suggests that the timing of tbx-2 transcriptional function likely initiates before the 1.5-fold stage, when TBX-2 appears completely nuclear.

• Primary Identifier: Expr4285
• Remark: Embryos at the ~200 cell stage contain 24 clonally committed pharyngeal precursors located in the anterior of the embryo (13 ABa-derived and 11 MS-derived), and the location of the 12 tbx-2::gfp expressing cells at this stage suggests that they are included among these precursors. To determine if these early tbx-2::gfp expressing cells were indeed pharyngeal precursors and to characterize their lineal origin, athors examined expression of a tbx-2::gfp promoter fusion containing the same tbx-2 5'-flanking sequences characterized above fused to gfp just downstream of the tbx-2 translation initiation codon (pOK206.30). Previous studies demonstrated that such promoter fusions can produce a longer lived GFP signal than full-length protein fusions. This tbx-2::gfp promoter fusion produced cytoplasmic GFP first detected in premorphogenetic embryos in the same pattern as full-length fusion protein, but GFP perdured in the pharynx until near hatching. GFP expression was observed in 3-fold embryos and early larvae in a reproducible subset of pharyngeal muscles, with occasional expression in body wall muscles and head neurons. GFP was observed predominantly in pharyngeal muscle types derived solely from ABa or from mixed lineages, and the number of these GFP-positive cells was generally consistent with those containing ABa-derived cells. However, exceptions to this generalization were found. Most notably, GFP was reproducibly observed in one MS-derived m7 muscle and all three m4 muscles (of which 2 contain only MS-derived cells). Taken together, these results strongly suggest that tbx-2::gfp expression in premorphogenetic embryos is limited to pharyngeal precursors, and most of these are ABa-derived, although expression is also likely in a small number of MS-derived pharyngeal precursors.
• Pattern: In transgenic embryos, this larger tbx-2::gfp reporter was expressed in a dynamic pattern, including in a subset of pharyngeal precursors in the premorphogenetic embryo, as well as body wall muscle and pharyngeal neurons. tbx-2::gfp expression initiated in 2 anterior cells in approximately 100 cell embryos and increased to 12 cells by approximately the 200 cell stage. The increasing number of GFP expressing cells was not due to cell divisions; rather tbx-2::gfp expression appeared to initiate asynchronously in individual cells. Expression in these cells was transient and was undetectable by the bean stage. Prior to the bean stage, tbx-2::gfp expression was also observed in body wall muscles, and later, in 2- to 3-fold embryos, expression was observed in a number of pharyngeal neurons. Expression in both of these tissues continued in larvae.
• Subcellular Localization: This full-length fusion protein is nuclear localized.

• Primary Identifier: Expr4286
• Remark: Reporter gene fusion type not specified.
• Pattern: Expression initiated in the pharyngeal neurons in late embryogenesis, but earlier expression was not observed.

• Primary Identifier: Expr4480
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in pharynx from L2 to adult, in some animals also expressed in pharyngeal neurons (not individually identified in this study) at L2/L3 and adult, head hypodermal cells/muscle from L4 to adult, posterior neurons from L4 to adult, body wall muscle from L4 to adult. Expressed in anterior neurons (not individually identified in this study) from L2 to adult.

• Primary Identifier: Expr4479
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in pharynx from L2 to adult, in some animals also expressed in pharyngeal neurons (not individually identified in this study) from L2 to L4 and head hypodermal cells/muscle at L4.

• Primary Identifier: Expr5294
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15588
• Reporter Gene: [C17H12.13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCAAACAATTCCAGCAAATTA] 3' and primer B 5' [TTCGCAGTGATATCTGGAAAATTA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head

• Primary Identifier: Expr5260
• Remark: Strain: BC13890
• Reporter Gene: [C13G3.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAATACCCTAAAAATCCCAACA] 3' and primer B 5' [GAAATGATAAATATGAGGGCCG] 3'.
• Pattern: Adult Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5231
• Remark: Strain: BC11858
• Reporter Gene: [C10C6.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGATGATGATTGCCAAATAAAA] 3' and primer B 5' [TGTCGCGATCTGAAAAAGAATA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head

• Primary Identifier: Expr5193
• Remark: Strain: BC14658
• Reporter Gene: [clp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGTGTCTATTTGTTTGTTGCC] 3' and primer B 5' [GTCGGCTTTTGCTGTGAAA] 3'.
• Pattern: Adult Expression: pharynx; vulval muscle; Nervous System; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; Nervous System; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5183
• Remark: Strain: BC10398
• Reporter Gene: [C06A8.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCCTATCATCTCCGACTTTT] 3' and primer B 5' [AACTAGAGTCTCCGAGGAAACAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; pharyngeal neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; Nervous System; pharyngeal neurons; unidentified cells in tail

• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5105
• Remark: Strain: BC15260
• Reporter Gene: [C02C2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATGAAGTGATGTTTCCGTT] 3' and primer B 5' [CGAAGGAGATTCCTCTTTTCAA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; pharyngeal neurons; Larval Expression: intestine; Nervous System; pharyngeal neurons

• Primary Identifier: Expr5499
• Remark: Strain: BC13408
• Reporter Gene: [hnd-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACCATCAAAGTCTCAGTCCGT] 3' and primer B 5' [GATTTGACGATTTTGTAGATGAGC] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; pharyngeal neurons; Larval Expression: pharynx; Nervous System; head neurons; pharyngeal neurons

• Primary Identifier: Expr5410
• Remark: Also expressed in (comments from author) : AFD + AWB amphid neurons (Thomas Lab 2005) Strain: BC12177
• Reporter Gene: [C33G8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCACATATGAAACATCCATGA] 3' and primer B 5' [CTCGCAGTCCGAGATTCTG] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; pharyngeal neurons; tail neurons; Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5374
• Remark: Strain: BC12787
• Reporter Gene: [C29E4.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAGTTTCTCTGGGAACG] 3' and primer B 5' [TCGGGACTCCGATAGCTG] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; pharyngeal neurons; Larval Expression: intestine; Nervous System; head neurons; pharyngeal neurons

• Primary Identifier: Expr5378
• Remark: Strain: BC15667
• Reporter Gene: [C29F9.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCGCGATTTTGTAATTTTTAAT] 3' and primer B 5' [TTAATGCAATATGAGCATTTCAGA] 3'.
• Pattern: Adult Expression: Nervous System; pharyngeal neurons; Larval Expression: intestine; Nervous System; pharyngeal neurons

• Primary Identifier: Expr5333
• Remark: Strain: BC15292
• Reporter Gene: [C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5085
• Remark: Strain: BC14118
• Reporter Gene: [B0546.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAAAGCACCGAAGACGTA] 3' and primer B 5' [CTTGAAACGCTGAGGATTCTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5058
• Remark: Strain: BC14133
• Reporter Gene: [unc-44::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCTGAGCGGAAATCTGT] 3' and primer B 5' [TCGTTCGAGATGGTCGGT] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr8268
• Remark: Picture: Fig. 1, A and C; Table 1.
• Pattern: Expression of SHL-1 was observed in posterior intestine, body wall muscle, vulval muscle, male-specific diagonal muscles, and a variety of motor neurons, interneurons, and sensory neurons.

• Primary Identifier: Expr7209
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14196
• Reporter Gene: [ZK370.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTCTGACACTCGGACATGC] 3' and primer B 5' [AACTGATCGAGATAACCGCATT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; spermatheca; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5736
• Remark: Strain: BC12190
• Reporter Gene: [unc-122::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTTACATCTCATATACTCTGGGC] 3' and primer B 5' [ATTGTGAGCCCAATGAAGTAAAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; coelomocytes; Nervous System; head neurons; pharyngeal neurons; Larval Expression: intestine; rectal gland cells; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in body

• Primary Identifier: Expr5722
• Remark: Also expressed in (comments from author) : expression in developing reproductive system.Mosaic population. Strain: BC14214
• Reporter Gene: [mig-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTATATTTTGGGAAATGCTGGAA] 3' and primer B 5' [TTTTAGATGTGAGTGTGCGCTT] 3'.
• Pattern: Adult Expression: intestine; body wall muscle; Nervous System; head neurons; pharyngeal neurons; Larval Expression: intestine; Reproductive System; body wall muscle; Nervous System; head neurons; pharyngeal neurons; unidentified cells

0 Life Stages

3 Parents

Definition	Name	Synonym	Primary Identifier
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
	pharyngeal cell		WBbt:0005460
The pharyngeal nervous system is composed of 20 pharyngeal neurons which lie completely within the pharynx.	pharyngeal nervous system		WBbt:0005440