WormMine: AnatomyTerm WBbt:0005812

• Definition: H-shaped cell associated with the excretory system, largest cell in C. elegans.
• Name: excretory cell
• Primary Identifier: WBbt:0005812
• Synonym: excretory canal cell

2 Children

Definition	Name	Synonym	Primary Identifier
Four processes (canals) of the excretory canal cell each contain a central collecting lumen which feeds to a central lumenal canal in the cell body; the central canal forms a specialized membrane to release fluids into the excretory duct. These five canals form a continuous H-shaped channel which extends almost the full length of the body, generally in contact with the lateral hypodermis and the pseudocoelom.	excretory canal	canal	WBbt:0005775
nucleus of pedigree ABplpappaap	ABplpappaap nucleus		WBbt:0002004

7 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_larva_enriched
	Single-cell RNA-Seq cell group 79_1 expressed in excretory.	scVI 0.6.0	WBPaper00065841:79_1
	Top 300 transcripts enriched in excretory cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_cell
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_larva_SelectivelyEnriched
	Transcripts enriched in Excretory_cell according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:Excretory_cell_enriched
	Single-cell RNA-Seq cell group 56 expressed in: Excretory cells.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:56

486 Expression Patterns

• Primary Identifier: Expr4831
• Remark: Picture: Figure 1B, I and II.
• Pattern: The promoter extracted from C15C7.2 is able to drive GFP expression in the excretory cell, pharynx, pharyngeal neurons, and head neurons.

• Primary Identifier: Expr4810
• Remark: Picture: Fig. 1, D and E. Reporter gene fusion type not specified.
• Pattern: VHA-5 is expressed in the H-shaped excretory cell. It is also expressed in the main epidermal syncytium, which had previously been overlooked. VHA-5 colocalized apically with the V1 subunit VHA-8 in both tissues.

• Primary Identifier: Expr4796
• Remark: Reporter gene fusion type not specified.
• Pattern: cnx-1 was expressed ubiquitously in every blastomere of the embryos up to the gastrulation stage but expression became gradually restricted to the head and tail regions at the comma stage during embryogenesis. During post-embryonic development, cnx-1 was expressed prominently in the H-shaped excretory cell, in the neurons of head and tail, in the dorsal and ventral nerve cords, and in the spermatheca. cnx-1 expression was also observed in the spicules of the male tail. The two head neurons expressing cnx-1 are ASK and ADL, and two tail neurons are PHA and PHB. Therefore, cnx-1 is expressed in head neurons including ASK and ASI chemosensory neurons and tail neurons including PHA and PHB.

• Primary Identifier: Expr4788
• Pattern: A full-length glt-3-gfp fusion (later shown to be capable of rescuing the phenotypes of a glt-3 mutant strain) is expressed at increasing levels from late embryogenesis to adulthood throughout the body-spanning excretory canal cell.
• Subcellular Localization: The expression of GLT-3::GFP appears localized to the abluminal (basolateral) side.

• Primary Identifier: Expr4778
• Pattern: Expressed in excretory cell.

• Primary Identifier: Expr4772
• Pattern: Expressed in excretory cell, muscle, hypodermis.

• Primary Identifier: Expr4773
• Pattern: Expressed in intestine, excretory cell, seminal vesicle/vas deferens.

• Primary Identifier: Expr4733
• Remark: rrc-1 = yk273h6
• Pattern: GFP expression was detected in the coelomocytes, excretory cell, and uterine-seam cell. GFP signals were also detected in a bilateral pair of cells near posterior isthmus of pharynx. These cells were identified as GLRL and GLRR based on their positions and characteristic morphology. Relatively weak expression was seen in developing embryos.

• Primary Identifier: Expr4393
• Pattern: The GFP signal was first detected from the 3-fold stage of embryogenesis during development. At the 3-fold stage, GFP expression was observed in hypodermal and intestinal tissues. During larval and adult stages, GFP was strongly detected in the hypodermis and intestine as well as the excretory cells.

• Primary Identifier: Expr4394
• Pattern: Antibody staining was detected in the H-shape excretory cells and the intestine.

• Primary Identifier: Expr4379
• Remark: No detailed description on life stages.
• Pattern: ZK795.3::GFP expression pattern includes spermatheca, hypodermal cells, pharynx and the excretory cell and channels. In the L3 stage, expression was seen in the vulva, and in P6.p descendants.

• Primary Identifier: Expr4218
• Remark: Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).
• Pattern: In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.

• Primary Identifier: Expr4594
• Pattern: Analysis of a reporter transgene revealed that act-5 expression is restricted to a small subset of cells within the C. elegans alimentary tract and excretory systems. GFP fluorescence was easily detected within a subset of embryonic, larval, and adult cells in transgenic animals, consistent with previous findings on the act-5 expression pattern. Within larvae and adults, GFP expression occurred within the 20 cells that comprise the adult intestine, and in two sets of three associated cells: one just anterior and one posterior to the intestine. The anterior set corresponds to the middle of three sets of pharyngeal-intestinal valve cells (vpi2), whereas the posterior group of associated cells comprises the rectal epithelial cell (rectD, rect_VL, rect_VR). Finally, the single excretory canal cell, which extends processes along the entire length of the worm, also showed GFP expression.

• Primary Identifier: Expr4611
• Pattern: Expressed in: excretory cell.

• Primary Identifier: Expr4612
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: excretory cell.

• Primary Identifier: Expr4613
• Pattern: Expressed in: excretory cell.

• Primary Identifier: Expr4614
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: excretory cell.

• Primary Identifier: Expr5295
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC10160
• Reporter Gene: [vha-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATCCGCCTGAAAAATCA] 3' and primer B 5' [GATTCCGATGGCTACAGTCG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in head; Larval Expression: hypodermis; excretory cell

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head

• Primary Identifier: Expr5253
• Remark: Strain: BC10460
• Reporter Gene: [C13C4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACAAAGTGTGGAAAAGGGA] 3' and primer B 5' [TTTGTTTCTCACGATCGTTCAC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; hypodermis; excretory cell

• Primary Identifier: Expr5255
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC15987
• Reporter Gene: [srr-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAATTGCATGTTTCAATGC] 3' and primer B 5' [TGGAGTAATGATTGTTGAAAAAG] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; excretory cell; Nervous System; head neurons; Larval Expression: pharyngeal gland cells; intestine; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr5256
• Remark: Strain: BC15141
• Reporter Gene: [srr-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCCGCATCATCTTTTTC] 3' and primer B 5' [GGACTTGGAGTAATGATTGTTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr5239
• Remark: Strain: BC10220
• Reporter Gene: [C11D2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTTCACCGAATGAACAGAT] 3' and primer B 5' [CGTCAATAAGGATTTTCTGACCT] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; Larval Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr5234
• Remark: Strain: BC14107
• Reporter Gene: [C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail

• Primary Identifier: Expr5216
• Remark: Strain: BC13544
• Reporter Gene: [dgk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCGTTTTAGCGAACATTGG] 3' and primer B 5' [GCTGCGATCTGGAATATCTCTT] 3'.
• Pattern: Adult Expression: Reproductive System; vulva other; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5210
• Remark: Strain: BC13714
• Reporter Gene: [C08F8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAAACCGGACGAGAAGAAT] 3' and primer B 5' [CGGCGATTTCTGAAGTTGTAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; excretory cell; Larval Expression: pharynx; intestine; body wall muscle

• Primary Identifier: Expr5214
• Remark: Strain: BC14111
• Reporter Gene: [rpl-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGTTTTGAAACACACCTCAA] 3' and primer B 5' [CTCACCTCATTTCGTCTTGCTAC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; Larval Expression: pharynx; body wall muscle; excretory cell; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5206
• Remark: Strain: BC11364
• Reporter Gene: [C08B6.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGACGTCGAATGTTTCCTTG] 3' and primer B 5' [TAGAGTGTAGAGATTGCGCGTC] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5207
• Remark: Strain: BC11365
• Reporter Gene: [C08B6.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGACGTCGAATGTTTCCTTG] 3' and primer B 5' [TAGAGTGTAGAGATTGCGCGTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell

15 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The fourth stage larva. At 25 Centigrade, it ranges 40-49.5 hours after fertilization, 26-35.5 hours after hatch.		L4 larva Ce	WBls:0000038
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	The third stage larva. At 25 Centigrade, it ranges 32.5-40 hours after fertilization, 18.5-26 hours after hatch.		L3 larva Ce	WBls:0000035
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	The C. elegans life stage spanning 620-800min(hatch) after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. A stage after elongation is over. The last stage of embryogenesis. Also called pre-hatched embryo, late embryo or morphogenetic embryo.		fully-elongated embryo Ce	WBls:0000021
	The C. elegans life stage spanning 350-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The stage that embryo starts elongation until elongation is over.		elongating embryo Ce	WBls:0000015
	The C. elegans life stage spanning 290-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage when embryo just finished gastrulation and is enclosing.		enclosing embryo Ce	WBls:0000013
	The C. elegans life stage spanning 100-290min after first cleavage at 20 Centigrade. Proliferate from 28 cells to 421 cells. Referring to the whole period of gastrulation.		gastrulating embryo Ce	WBls:0000010
	The C. elegans life stage spanning 0-350min after first cleavage at 20 Centigrade. Proliferate from 1 cell to 560 cells. From start of first cleavage until cleavage is over.		proliferating embryo Ce	WBls:0000004
	The C. elegans life stage spanning 520-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and tripple fold. A stage between 2-fold embryo and fully-elongated embryo. Also called pretzel embryo or pretzel stage.		3-fold embryo Ce	WBls:0000020
	The C. elegans life stage spanning 420-460min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and fold back 50%. A stage between comma embryo and 2-fold embryo.		1.5-fold embryo Ce	WBls:0000018
	The C. elegans life stage spanning 390-420min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo looks like a comma. A stage between bean embryo and 1.5-fold embryo.		comma embryo Ce	WBls:0000017
	The C. elegans life stage spanning 460-520min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and double fold. A stage between 1.5-fold embryo and 3-fold embryo.		2-fold embryo Ce	WBls:0000019
	The C. elegans life stage spanning 350-390min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. Emrbyo elongation started but have not formed comma shape yet. The shape of embryo looks like a lima bean. A stage right before comma embryo. Also called lima embryo or lima bean stage.		bean embryo Ce	WBls:0000016
	The C. elegans life stage spanning 210-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage before the fast cleavage of cells finishes.		late cleavage stage embryo Ce	WBls:0000014

3 Parents

Definition	Name	Synonym	Primary Identifier
a cellular object that consists of subcellular components, expresses genes or functions.	Cell	Cell type	WBbt:0004017
	excretory system		WBbt:0005736
embryonic cell	ABplpappaa		WBbt:0006551