WormMine: AnatomyTerm WBbt:0006749

• Definition: the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.
• Name: nerve ring
• Primary Identifier: WBbt:0006749
• Synonym: circumpharyngeal nerve ring

0 Children

4 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Enriched in vulval muscle (adult), ventral nerve cord (larva), ventral nerve cord (adult), dorsal nerve cord (adult), body neurons (adult), body neurons (larva), tail neurons (larva), nerve ring (larva), dorsal nerve cord (larva), nerve ring (adult), body wall muscle (larva), lateral nerve cords/commissures (larva).		WBPaper00029359_1197
	Enriched in ventral nerve cord (larva), vulval muscle (adult), ventral nerve cord (adult), body neurons (adult), body neurons (larva), dorsal nerve cord (adult), tail neurons (larva), dorsal nerve cord (larva), nerve ring (adult), nerve ring (larva), tail neurons (adult), body wall muscle (larva).		WBPaper00029359_1291
	Enriched in vulval muscle (adult), ventral nerve cord (larva), ventral nerve cord (adult), dorsal nerve cord (adult), body neurons (adult), body neurons (larva), tail neurons (larva), nerve ring (larva), nerve ring (adult), dorsal nerve cord (larva), body wall muscle (larva), lateral nerve cords/commissures (larva), tail neurons (adult).		WBPaper00029359_1546
	Transcripts expressed in nerve ring, according to RNA tomography.	RNA tomography	WBPaper00055648:nerve-ring_expressed

812 Expression Patterns

• Primary Identifier: Expr4833
• Remark: Picture: Figure 1D, I and II.
• Pattern: The promoter extracted from B0336.3 is able to drive GFP expression in hypodermis, pharyngeal gland cell, gut, and nerve ring.

• Primary Identifier: Expr4995
• Remark: Picture: Fig 1C. Reporter gene fusion type not specified.
• Pattern: The CKR-1::GFP transgenics showed GFP expression in several nerve ring neurons.

• Primary Identifier: Expr4996
• Remark: Picture: Fig 1F. Reporter gene fusion type not specified.
• Pattern: GFP fluorescence was consistently and specifically found in the intestine and a few nerve ring neurons in all TPPII transgenic lines.

• Primary Identifier: Expr4956
• Remark: Picture: Fig. 5, Fig 6.
• Pattern: NAB-1::GFP expression is restricted to epithelia and neurons. The earliest expression was observed in the hypodermis of 2-fold-stage early embryos. Immediately prior to hatching, this expression became restricted to the epithelial excretory canal and the nervous system, including the central nervous system and the motoneurons (dorsal and ventral nerve cords. In L3 and L4 larvae, NAB-1::GFP also localized transiently at the membranes of the developing vulva epithelia. Also expressed in distal tip cell (pers. comm. from Wesley Hung 11-17-07.)
• Subcellular Localization: NAB-1::GFP puncta partially co-localized with the synaptic-vesicle protein SNT-1 and the active-zone protein UNC-10, suggesting that NAB-1 is present in presynaptic regions that are associated with vesicle pools and active zones. Similar to NAB-1, SAD-1 also showed co-localization with SNT-1. NAB-1::GFP and SAD-1 also showed partial co-localization, where each NAB-1::GFP punctum was associated with SAD-1 staining.

• Primary Identifier: Expr4386
• Pattern: SDN-1::GFP transgenes were expressed in many ventral neuroblasts during their migrations, prior to and during epidermal enclosure; in later embryogenesis SDN-1::GFP was mainly expressed in the nervous system (nerve ring localization, nr) and pharynx (ph).

• Primary Identifier: Expr4346
• Pattern: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. No specific staining was found in animals that did not express any tagged nAChR subunit.
• Subcellular Localization: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located.

• Primary Identifier: Expr4347
• Pattern: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. No specific staining was found in animals that did not express any tagged nAChR subunit.
• Subcellular Localization: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located.

• Primary Identifier: Expr4266
• Pattern: Reporter genes that begin at -3190, -2021, -1248, and -517 bp upstream of the ATG of this alternate first exon 1 were expressed in body wall muscle cells, neurons in the head, nerve ring, ventral and dorsal nerve cords, neurons, and some epidermal cells in the tail. Weaker expression was also observed in pharyngeal muscles. The expression from promoter 2 started in the embryos at the 1.5-fold stage and was continuous throughout development. Expression from this internal promoter element is observed in vulval cells at the L4 stage and in adult hermaphrodites, including the uterine vulval cells uv1, 2, 3, and surrounding epithelium.

• Primary Identifier: Expr4252
• Remark: mig-5::gfp rescued the mig-5(ok280) B cell polarity defect.
• Pattern: Animals that contained mig-5::gfp expressed GFP in the B, QL cell and several cells in the nerve ring. MIG-5::GFP was expressed strongly in the B cell and its descendants.

• Primary Identifier: Expr4574
• Pattern: In wild-type animals, sax-7 is expressed in multiple tissues with robust SAX-7 accumulation in the nervous system. Expression was detected in pharynx, gonad, and the nerve ring and ventral nerve cord.

• Primary Identifier: Expr4663
• Pattern: ppk-1::GFP expression was observed in such somatic tissues as gonad sheath and spermatheca, distal tip cells, and uterine and vulva muscles. ppk-1::GFP also showed extensive expression in such neuronal cells as ventral nerve cord, neuronal cell bodies near the nerve ring, and tail neurons.

• Primary Identifier: Expr4446
• Pattern: F27E11.3A is expressed in three cells around the nerve ring, possibly neurons, in two cells in the posterior bulb of the pharynx, and in the pharyngeal marginal or muscle cells.

• Primary Identifier: Expr4442
• Pattern: T23D8.1 is expressed in a few cells in the nerve ring, putatively identified as neurons. In addition, there is also expression in the intestine, in one cell on the ventral side of the terminal pharyngeal bulb and two cells around the anus.

• Primary Identifier: Expr4556
• Pattern: Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head.
• Subcellular Localization: Expressed in the cell bodies and processes of neurons.

• Primary Identifier: Expr4557
• Pattern: Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head.
• Subcellular Localization: Expressed in the cell bodies and processes of neurons.

• Primary Identifier: Expr5296
• Remark: Strain: BC10524
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5297
• Remark: Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5291
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173
• Reporter Gene: [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5294
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15588
• Reporter Gene: [C17H12.13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCAAACAATTCCAGCAAATTA] 3' and primer B 5' [TTCGCAGTGATATCTGGAAAATTA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5285
• Remark: Also expressed in (comments from author) : Head neurons are mechanosensory, possibly the CEP sensilla. Strain: BC10478
• Reporter Gene: [C17E4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGACTAGGCGACGATGA] 3' and primer B 5' [TTATCGCTGATAATGTGAACGAGT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; tail neurons; unidentified cells; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons

• Primary Identifier: Expr5281
• Remark: Also expressed in (comments from author) : Notes have been lost. 2 images taken and posted, appears neural. Strain: BC10763
• Reporter Gene: [ceh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAGTATCCTCTGCATCGGT] 3' and primer B 5' [GTATCGGCAGAAGGGATAGTTG] 3'.
• Pattern: Larval Expression: Nervous System; nerve ring; head neurons

• Primary Identifier: Expr5279
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14128
• Reporter Gene: [C16C10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGCCATATTGGTAGCTGTGG] 3' and primer B 5' [GACCGTTGCTGATTTTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5271
• Remark: Strain: BC10466
• Reporter Gene: [nnt-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCCCTCATTGATTGTGATCT] 3' and primer B 5' [CGAAGAATGACGATGCTGAA] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5260
• Remark: Strain: BC13890
• Reporter Gene: [C13G3.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAATACCCTAAAAATCCCAACA] 3' and primer B 5' [GAAATGATAAATATGAGGGCCG] 3'.
• Pattern: Adult Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5261
• Remark: Strain: BC14496
• Reporter Gene: [C13G3.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGTTCCGCAGACGC] 3' and primer B 5' [TGCAGGAATGATATCTCCTAGAAA] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5251
• Remark: Also expressed in (comments from author) : unidentified cells around vulva. Strain: BC11358
• Reporter Gene: [C13B9.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCTTGAAACATGATTGCCC] 3' and primer B 5' [ATCCGCGATGATATGAGTCAG] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ; Larval Expression: body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body

• Primary Identifier: Expr5252
• Remark: Strain: BC13896
• Reporter Gene: [C13C4.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCACTTCTCCTCTTATCGC] 3' and primer B 5' [GATTCTTCGACCCTAAAGTTTCAA] 3'.
• Pattern: Adult Expression: Reproductive System; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5257
• Remark: Strain: BC10218
• Reporter Gene: [C13F10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCTGGAAAAGTTAACAAAA] 3' and primer B 5' [GATCCATGAAACTGTTGAGTCTG] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5258
• Remark: Strain: BC10711
• Reporter Gene: [C13F10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCTGGAAAAGTTAACAAAA] 3' and primer B 5' [GATCCATGAAACTGTTGAGTCTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5246
• Remark: Strain: BC11926
• Reporter Gene: [C12D8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGAATGTGTACGAACGATCTG] 3' and primer B 5' [TCCTTCGATTTGATTCACAAAGT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

0 Life Stages

3 Parents

Definition	Name	Synonym	Primary Identifier
anterior-most body region containing the pharynx.	head		WBbt:0005739
entity of anatomical origin that is either entirely acellular or is a collection of cells and acellular parts.	Anatomy	anatomical structure	WBbt:0005766
Part of the nervous system that lies completely outside the pharynx.	somatic nervous system		WBbt:0005760