WormMine: AnatomyTerm WBbt:0005793

• Definition: Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis).
• Name: arcade cell
• Primary Identifier: WBbt:0005793

2 Children

Definition	Name	Synonym	Primary Identifier
Interface between pharynx and hypodermis, form anterior part of the buccal cavity.	anterior arcade cell	arc ant	WBbt:0005794
Interface between pharynx and hypodermis, form anterior part of the buccal cavity.	posterior arcade cell	arc post	WBbt:0005795

6 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts uniquely expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_enriched
	Single-cell RNA-Seq cell group 15_0 expressed in epithelium.	scVI 0.6.0	WBPaper00065841:15_0
	Top 300 transcripts enriched in arcade cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Arcade_cell_anterior_and_posterior
	Single-cell RNA-Seq cell group 82_1 with unidentified tissue expression pattern.	scVI 0.6.0	WBPaper00065841:82_1
	Single-cell RNA-Seq cell group 40 expressed in: Arcade cells and rectal gland subpopulation.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:40

67 Expression Patterns

• Primary Identifier: Expr4837
• Remark: Picture: Figure 5.
• Pattern: Fluorescence started to be visible in two cells of young embryos at around the 64 AB cell stage. Towards the end of gastrulation expression was visible in about 40 cells throughout the embryo including neuronal precursors, ventral hypodermal cells, and pharyngeal precursor cells. At the 1 to 2 fold stages fluorescence was observed in IL1 neurons (the identity was determined post-embryonically), the nine buccal epidermal cells, and additional cells in the head, most likely arcade cells. Transient expression was also observed in embryonic motoneurons (no longer visible in 3 fold stage embryos) and in a few apoptotic cells in the head. Based on their position they could be the sister cells of some of the IL1 neurons, which are known to undergo programmed cell death at this developmental stage. At the 3 fold stage expression was restricted to the buccal epidermal cells, most of the arcade cells (3 anterior and the DL and DR posterior arcade cells), and the six IL1 neurons. The two lateral IL1 neurons expressed the marker only weakly also in the L1 larval stage (but not later during development), whereas the dorsal and ventral IL1 neurons expressed GFP strongly throughout all larval stages and in the adults. Starting from the L1 larval stage expression could also be observed in the posterior cells of the gut. Starting from the L2 stage, when gonad development and migration begins, fluorescence became also visible in the distal tip cells of the gonad.

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5208
• Remark: Strain: BC12550
• Reporter Gene: [C08C3.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTTTAAACGACCTGAAAGGAT] 3' and primer B 5' [GCGACGATTTTGAAGAGTTTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; Larval Expression: pharynx; arcade cells; pharyngeal-intestinal valve; intestine; rectal gland cells

• Primary Identifier: Expr5180
• Remark: Strain: BC11438
• Reporter Gene: [srp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAATTTGGCGAGAATTTCCA] 3' and primer B 5' [GCGAAAAGCTGATAATTACACGA] 3'.
• Pattern: Adult Expression: body wall muscle; Larval Expression: arcade cells; body wall muscle

• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5121
• Remark: Also expressed in (comments from author) : mosaic population Strain: BC14138
• Reporter Gene: [lin-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTTTGCTAGCCTTGAAACAAGT] 3' and primer B 5' [CGATAGTTGTTATTTGGAGAGCTG] 3'.
• Pattern: Adult Expression: arcade cells; intestine; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: arcade cells; intestine; Reproductive System; developing vulva; body wall muscle; excretory cell; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5513
• Remark: Strain: BC14317
• Reporter Gene: [C46C11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGCAGTGTTTGCGGAAGG] 3' and primer B 5' [CGTTTCGGGATTGTTTCAGT] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5336
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15590
• Reporter Gene: [C25E10.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCTTTTTCCTTCTTCCTCTGA] 3' and primer B 5' [AGTTGTCCGAGATTCTGAAAAATA] 3'.
• Pattern: Adult Expression: arcade cells; intestine; hypodermis; seam cells; Nervous System; head neurons; Larval Expression: arcade cells; intestine; hypodermis; seam cells; Nervous System; head neurons

• Primary Identifier: Expr5330
• Remark: Strain: BC15287
• Reporter Gene: [grl-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATGGCAACGATGAATAAA] 3' and primer B 5' [CTTTCATTGCGTCATTCTTTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: arcade cells; intestine; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5038
• Remark: Also expressed in (comments from author) : head neurons are possibly the Labial Sensilla Strain: BC15645
• Reporter Gene: [B0285.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGACACATTGCAAAAACTTCTTA] 3' and primer B 5' [CGATATTTCGATGGCTGAAAA] 3'.
• Pattern: Adult Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; Larval Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head

• Primary Identifier: Expr7192
• Remark: Strain: BC14571
• Reporter Gene: [ZK1193.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCCCTCTCTCTCTCTCTCT] 3' and primer B 5' [CCTCATTGGGAAGATATCTAGCTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; rectal epithelium; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr11300
• Pattern: Strong expression at all stages (starting in the embryo), vulval epithelium, spermatheca, uterus, arcade cells?, CEPsh?, several unidentified head cells

• Primary Identifier: Expr5738
• Remark: Strain: BC10576
• Reporter Gene: [F11D5.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAACAAGCCATTTCCCCC] 3' and primer B 5' [GCAGCAACTTGATCCTGACA] 3'.
• Pattern: Adult Expression: arcade cells; intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: arcade cells; intestine; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5706
• Remark: Strain: BC14288
• Reporter Gene: [F09G2.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGACTCCTATGGTTGCATTTTCA] 3' and primer B 5' [CTGAATCCTTCAATTTTTGTTCG] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; Larval Expression: pharynx; arcade cells; intestine; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5594
• Remark: Strain: BC15276
• Reporter Gene: [grl-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGACGCTAAGGACAGAAAA] 3' and primer B 5' [GAGGATGCCTTGTTGGTTACA] 3'.
• Pattern: Adult Expression: pharynx; Larval Expression: pharynx; arcade cells; hypodermis

• Primary Identifier: Expr5535
• Remark: Also expressed in (comments from author) : No comment. Strain: BC12652
• Reporter Gene: [egl-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGTTGCACCCTTCTTG] 3' and primer B 5' [CCTGACATGATGGACACAGG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; seam cells; Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; seam cells

• Primary Identifier: Expr5949
• Remark: Strain: BC15328
• Reporter Gene: [F35B12.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAGCTGTGACCTGAATAAAT] 3' and primer B 5' [CGGATTTCTGTAGATAAATGGGTT] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; Larval Expression: pharynx; arcade cells

• Primary Identifier: Expr5936
• Remark: Strain: BC15244
• Reporter Gene: [grl-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGCCTTTTTCTTGCAT] 3' and primer B 5' [CAATGCTAAAGCTAAATGCCG] 3'.
• Pattern: Larval Expression: arcade cells

• Primary Identifier: Expr11293
• Pattern: Expressed in pharyngeal marginal cells, some arcade cells, in early larvae: gut.

• Primary Identifier: Expr6579
• Remark: Also expressed in (comments from author) : good example of arcade cells Strain: BC14672
• Reporter Gene: [T03F6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAATTTTTCGGTGAAAATCAATA] 3' and primer B 5' [TGGGCTGAAATCAAATTAGAAAA] 3'.
• Pattern: Adult Expression: arcade cells; intestine; Reproductive System; vulva other; unidentified cells in tail ; Larval Expression: arcade cells; intestine; unidentified cells in tail

• Primary Identifier: Expr6576
• Remark: Strain: BC15224
• Reporter Gene: [grl-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGCTGCAGTACATCCCAAA] 3' and primer B 5' [TGAAAATAGGCTAAACAAGCC] 3'.
• Pattern: Larval Expression: arcade cells; Reproductive System; developing vulva

• Primary Identifier: Expr6473
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11416
• Reporter Gene: [clh-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGAAGCATAAAATGTCGGG] 3' and primer B 5' [CGGCGTACATAGTAAAATTAACCC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulva other; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; arcade cells; pharyngeal-intestinal valve; intestine; excretory cell; Nervous System; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr6475
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12201
• Reporter Gene: [R07B7.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGTTGGAGATCACAAATGC] 3' and primer B 5' [AGCAATCTGATGAGTCTGGAAAA] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; unidentified cells; Larval Expression: pharynx; arcade cells; body wall muscle

• Primary Identifier: Expr6431
• Remark: Strain: BC15846
• Reporter Gene: [M176.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGACGTGTTTTGAAGTGTGC] 3' and primer B 5' [TTTAACAAAATATGGGGCACG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: arcade cells; intestine

• Primary Identifier: Expr6411
• Remark: Strain: BC14511
• Reporter Gene: [M03A1.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTGAGTTCTTTGGCAGTTTTC] 3' and primer B 5' [CGTTTGAGCCATCGTGTATTT] 3'.
• Pattern: Adult Expression: arcade cells; intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; pharyngeal neurons; Larval Expression: arcade cells; intestine; rectal gland cells; body wall muscle; hypodermis; excretory cell; Nervous System; pharyngeal neurons

• Primary Identifier: Expr6774
• Remark: Also expressed in (comments from author) : unidentified cells in head, possibly labial sensilla. Strain: DM12747
• Reporter Gene: [set-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTACGCTCATCAGGCAGTAGTTT] 3' and primer B 5' [CCTTCGAGTGACACCGCT] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; Reproductive System; vulval muscle; vulva other; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head; Larval Expression: arcade cells; intestine; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head

• Primary Identifier: Expr6825
• Remark: Strain: BC14538
• Reporter Gene: [lbp-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAACCGCTTAAAATCATTGAG] 3' and primer B 5' [CAGCAGAGATTCTGAAAATTTGG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; Reproductive System; vulva other; seam cells; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; seam cells; unidentified cells in tail

• Primary Identifier: Expr6668
• Remark: Strain: BC11116
• Reporter Gene: [snb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGTATCCTGATGTCCCGATT] 3' and primer B 5' [TCGTCAAGATGGTCTTATCCG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; Reproductive System; distal tip cell; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; Reproductive System; developing gonad; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in tail

• Primary Identifier: Expr6155
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14284
• Reporter Gene: [F53E4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACCCGTGTAATTTTTGATGTT] 3' and primer B 5' [GTCCATGTGGCGATTTTTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail

• Primary Identifier: Expr6006
• Remark: Strain: BC15280
• Reporter Gene: [grl-27::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAAATTGGCCGTAACAAC] 3' and primer B 5' [GAAGGGAGGATTGGATGATGT] 3'.
• Pattern: Adult Expression: arcade cells; Larval Expression: arcade cells

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
an epithelial cell that serves either to bridge two neighboring epithelial tissues or to form an opening in the epithelium.	interfacial epithelial cell	interfacial cell	WBbt:0005754