WormMine: AnatomyTerm WBbt:0005796

• Definition: intestinal muscle cell, attach to intestine and body wall anterior to anus
• Name: intestinal muscle
• Primary Identifier: WBbt:0005796
• Synonym: stomato-intestinal muscle

2 Children

Definition	Name	Synonym	Primary Identifier
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in intestinal muscle, anal depressor muscle according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:mu_int_mu_anal
	Top 300 transcripts enriched in intestinal muscle, rectal muscle according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Intestinal_and_rectal_muscle

113 Expression Patterns

• Primary Identifier: Expr4820
• Remark: Picture: Figure S1.
• Pattern: Expressed in head neurons, ventral-cord motor neurons, body-wall muscle, vulval muscle, stomatointestinal muscle, anal-depressor muscle, tail neurons, etc.

• Primary Identifier: Expr4819
• Remark: Picture: Figure S1.
• Pattern: Expressed in head neurons, ventral-cord motor neurons, body-wall muscle, vulval muscle, stomatointestinal muscle, anal-depressor muscle, tail neurons, etc.

• Primary Identifier: Expr4809
• Remark: Picture: Figure 8. Staining was greatly reduced in unc-87(e843).
• Pattern: The antibody react with body wall muscle, pharyngeal muscle, anal depressor and sphincter muscle, intestinal muscles, vulval muscles and uterine muscles. In all cases, UNC-87 was contained withing the pattern observed with phalloidin or anti-actin antibodies, suggesting colocalization with thin filaments..
• Subcellular Localization: Immunohistochemical staining of wild type adult body wall muscle revealed a atriated pattern. The striations are interupted periodically along their length by unstained regions. Double labelling experiments showed that anti-UNC-87 staining pattern corresponded with that of the monoclonal antibody MH44. This pattern represent the I band. At the center of the I band are the dense bodies, these correspond to the unstained regions within the striations.

• Primary Identifier: Expr4764
• Pattern: CO3H5.2 gene has a broad expression pattern. This includes expression in the pharynx and pharyngeal gland cells, seam cells, spermatheca, stomatointestinal muscle, vulva and body wall muscle.

• Primary Identifier: Expr4734
• Pattern: A transcriptional arg-1::gfp reporter is expressed in the head mesodermal cell, the vulval muscles, and the enteric muscles.

• Primary Identifier: Expr4940
• Pattern: strong bwm, vul, mu int, occaisonal weak pharyngeal, spermatheca, faint VNC, head neurons; embryonic bwm starts at 3-fold and very strong in L1s.

• Primary Identifier: Expr4942
• Pattern: strong bwm, vul, anal dep, mu int; strain A shows embryonic bwm starting at 1.5 fold and strong at 3-fold

• Primary Identifier: Expr4943
• Pattern: strong 3-fold emb bwm that fades and becomes mosaic in late L's and adults, vul, anal dep, spinchter, mu int; seam cells in one line at least

• Primary Identifier: Expr4934
• Pattern: strong bwm, pharyngeal, vul, anal, mu int, sphincter muscles; no embryonic seen

• Primary Identifier: Expr4920
• Pattern: Faint vul, sphincter, anal dep, mu int; faint head neurons; rare spermatheca; bean to L1 see head bwm?- 4 quads of single to double cells GFP+ that don't exactly look like bwm close to bwm position - could be unhappy bwm due to exp?

• Primary Identifier: Expr4918
• Pattern: Strong vul, bwm, anal, mu int, sphincter, head neurons.

• Primary Identifier: Expr4919
• Pattern: Strong pharyngeal, vulval, bwm, anal dep, mu int; 3-fold earliest embryonic.

• Primary Identifier: Expr4911
• Remark: Picture: Fig S5.
• Pattern: A transcriptional fusion of the unc-50 promoter to GFP is expressed in all cell types throughout development. unc-50::gfp expression was seen in the head of adult hermaphrodite. Expression is seen in the pharyngeal muscle, head neurons, and epidermis. Expression is also present in the gut, ventral cord motor neurons, and epidermal seam cells. In the mid body region expression is seen in the gut, seam cells, uterus, vulva muscles, and distal tip cell. In the tail region unc-50 expression can be detected in the epidermis and enteric muscles.

• Primary Identifier: Expr4350
• Pattern: Localized differently within cells and GFP fluorescence was seen in body wall muscle, distal tip cells, enteric muscle and cells of the posterior intestine. Within the pharynx, cca-1 expression is observed in most if not all pharyngeal muscle cells but is most prominent in those of the procorpus and in pm8, the most posterior cell in the terminal bulb.

• Primary Identifier: Expr8970
• Remark: Picture: Fig 7.
• Pattern: GFP expression was observed in several neurons including head neurons, motor neurons located in the ventral nerve cord, HSN and CAN neurons, and tail neurons. However, rep-1 does not seem to be expressed in all the neurons. Not only was GFP involved in the neuronal expression, it was also expressed in various muscles such as body-wall, pharyngeal, intestinal and anal sphincter, in addition to the seam cells, hypodermis and the intestine.

• Primary Identifier: Expr39
• Pattern: All hatched stages exhibit expression in three cells in the anal region of the worm. One is positioned directly over the anal duct in the intestino-rectal region, and has thus been identified as the anal sphincter cell. The remaining two are symmetrically placed on the lateral ventral surfaces of the posterior intestine, a position consistent with that of the two intestinal muscles. These cells form part of the machinery necessary for the process of defecation in C.elegans

• Primary Identifier: Expr12085
• Pattern: plr-1::GFP expression became visible in late gastrulation stage embryos. Strongest expression was detected in many cells in the tail region and by comma stage the most prominent expression was seen in body wall muscle cells. In early larval stages expression was detectable in a number of different tissues including the major hypodermal cells, muscle and marginal cells of the pharynx, the intestine (strongest in the anteriormost and posteriormost cells) as well as the anal depressor and stomatointestinal muscle. In the nervous system GFP expression was visible in a few neurons in head ganglia, many ventral cord motor neurons and several neurons in the tail ganglia including the PDA neuron. Based on the lack of commissures the motor neurons are likely of the VA, VB, VC and/or AS class. Based on the number of cells the majority (or even all) of these classes express GFP. In general expression was strongest in the tail region throughout development. This also held true for the motor neurons in the ventral cord, where GFP was strongest in the posterior-most cells and barely detectable in anterior motor neurons. Expression is maintained throughout larval development. In later larval stages expression is also seen occasionally in the distal tip cell of the developing gonad, the vulva and uterine muscle cells and the VC4 and VC5 neurons flanking the vulva. Expression in AVG, HSN or CAN neurons was not detectable with this reporter construct, but was detected in a previous study in HSN and CAN using a longer genomic construct (Moffat et al., 2014, Expr11480).

• Primary Identifier: Expr687
• Remark: Reporter gene fusion type not specified. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Expression is observed in newly hatched L1 larvae and late stage embryos. There is strong staining of the marginal cells (AB-derived) in the pharynx; also there is staining in the posterior gut near the anal region (cells may be sphincter cells, rectal intestinal valve or the posterior intestinal muscle cells). L1-L4 pharyngeal cells and cells in the posterior gut region (staining of posterior cells reduces in later stages). L1-L2 occasional staining in the gut lumen or posterior intestinal cells. Intensity of staining in intestinal lumen decreases gradually during L2, L3 and L4 BUT pharyngeal cells continue to stain. Adults: rare intestinal staining and strong pharyngeal staining is observed klp-3 gene may be expressed in sphincter muscle of the intestino-rectal valve and the intestinal muscles located anterior to the anus which are attached to the intestine and body wall. The stained cells in posterior intestinal region are descendants of AB founder cells.

• Primary Identifier: Expr1124
• Pattern: Excretory cell, vulva, hermaphrodite-specific neurons, enteric muscles, first four epithelial cells of intestine, and the uterus.

• Primary Identifier: Expr10714
• Pattern: The hst-3.2 reporter displayed almost ubiquitous expression early during embryogenesis but, during larval stages and adulthood became more restricted to epithelia and neurons. We detected expression in the hypodermis (excluding obvious expression in the seam cells) and the vulval epithelium. In addition, we observed expression in about two dozen head neurons and possibly the enteric muscle. Again, no obvious expression was seen in HSN neurons.

• Primary Identifier: Expr9488
• Pattern: Transgenic animals expressed this reporter specifically in muscle. Strong expression was observed in muscle cells in embryos. Adult expression was seen in striated body-wall muscle along the length of the animal, especially in the head. Strong expression was also seen in the vulval muscles. Additional expression was observed in intestinal muscle, anal sphincter muscle and the sex-specific muscles of the male tail. No expression was observed in pharyngeal muscle.
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Nucleus only

• Primary Identifier: Expr14757
• Pattern: endu-2::gfp was expressed in intestine and various muscle cells, including head muscle arm, vulval muscle, intestinal muscle, and anal depressor muscle.

• Primary Identifier: Expr9177
• Pattern: Strong expression was observed in head neurons, nerve ring, ventral cord, tail neurons, body-wall muscle, head muscle, vulval muscle, anal depressor muscle, and stomatointestinal muscle. bkip-1 was also expressed in head mesodermal cell.
• Subcellular Localization: BKIP-1 was enriched in the nerve ring and in body-wall muscle dense bodies.

• Primary Identifier: Expr8959
• Remark: Picture: Fig 7.
• Pattern: STN-2::GFP is expressed in the nervous system and in body-wall, vulval, and enteric muscles. In neurons, STN-2::GFP is localized to the cell bodies and their processes.
• Subcellular Localization: While it is apparent that STN-2::GFP is localized in the cytoplasm, the robust expression of STN-2::GFP makes it difficult to rule out membrane localization of the protein. Similar to neurons, STN-2::GFP is largely cytoplasmic in body-wall muscles. However, a subpopulation of STN-2::GFP localized to distinct muscle structures that include sarcomeres as well as in muscle membrane boundaries. In neurons, STN- 2TGFP is localized to the cell bodies and their processes While it is apparent that STN-2::GFP is localized in the cytoplasm, the robust expression of STN-2::GFP makes it difficult to rule out membrane localization of the protein. Similar to neurons, STN-2::GFP is largely cytoplasmic in body-wall muscles. However, a subpopulation of STN-2::GFP localized to distinct muscle structures that include sarcomeres as well as in muscle membrane boundaries.

• Primary Identifier: Expr9102
• Remark: Picture: Figure 2.
• Pattern: Two independent transgenic strains were created that expressed GFP under the control of the ctn-1 promoter (Pctn-1) and slo-1 promoter (Pslo-1), respectively. The expression pattern of ctn-1 largely overlapped with that of slo-1. Specifically, both ctn-1 and slo-1 were expressed in many neurons and several types of muscles, including body-wall muscle, vulval muscle and stomatointestinal muscle. However, slo-1 appeared to be expressed in more neurons in the head than ctn-1, whereas ctn-1 was expressed in pharyngeal muscle cells and some other unidentified cells that did not express slo-1.

• Primary Identifier: Expr9103
• Remark: Picture: Figure 2.
• Pattern: Two independent transgenic strains were created that expressed GFP under the control of the ctn-1 promoter (Pctn-1) and slo-1 promoter (Pslo-1), respectively. The expression pattern of ctn-1 largely overlapped with that of slo-1. Specifically, both ctn-1 and slo-1 were expressed in many neurons and several types of muscles, including body-wall muscle, vulval muscle and stomatointestinal muscle. However, slo-1 appeared to be expressed in more neurons in the head than ctn-1, whereas ctn-1 was expressed in pharyngeal muscle cells and some other unidentified cells that did not express slo-1.

• Primary Identifier: Expr15542
• Pattern: MPS-2 was detected throughout development with broad expression in the embryo, including the epidermis, gut, and differentiating neurons. During larval development, expression becomes weaker and more restricted and adult worms show MPS-2 expression only in a couple of cells, including body-wall muscle, rectal muscle, somato-intestinal muscle, inconsistently in coelomocytes, and robust expression in the AVA neuron, which plays an important role in memory. On the other hand, con- trary to a previous study, MPS-2 was not detectable in the ADF neuron.

• Primary Identifier: Expr9433
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca uterine valve; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Dense bodies, Thick filaments and/or M-line, SR/ER

• Primary Identifier: Expr9532
• Remark: Operon: CEOP1360
• Reporter Gene: The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons. Larval Expression: intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; gonad sheath cells; body wall muscle; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Mitochondria

• Primary Identifier: Expr9565
• Reporter Gene: The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells. Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other

0 Life Stages

3 Parents

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Any muscle cell that is not pharyngeal.	body muscle cell		WBbt:0007810
Muscle cell of the alimentary canal, excluding the pharynx.	enteric muscle		WBbt:0008600