WormMine: AnatomyTerm WBbt:0005799

• Name: rectal gland cell
• Primary Identifier: WBbt:0005799

3 Children

Definition	Name	Synonym	Primary Identifier
Rectal epithelial cells, adjacent to intestino-rectal valve, have microvilli	rect_D	lineage name: ABplpappppp	WBbt:0004788
Rectal epithelial cells, adjacent to intestino-rectal valve, have microvilli	rect_VL	lineage name: ABplppppaap	WBbt:0004787
Rectal epithelial cells, adjacent to intestino-rectal valve, have microvilli	rect_VR	lineage name: ABprppppaap	WBbt:0004776

3 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in rectal gland cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Rectal_gland
	Single-cell RNA-Seq cell group 30_3 expressed in gland.	scVI 0.6.0	WBPaper00065841:30_3
	Single-cell RNA-Seq cell group 40 expressed in: Arcade cells and rectal gland subpopulation.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:40

285 Expression Patterns

• Primary Identifier: Expr4684
• Pattern: GFP expression was detected at most developmental stages, with the spatial expression depending on the developmental stage of the animal. Neuronal expression of hlh-29 was detected in larvae and adults in both amphid and phasmid sockets, in the ALA and PVT neurons, in the chemosensory and mechanosensory neurons, ASI, ASK, PHA, and PQR, and in neurons of the anterior pharyngeal bulb. Weaker expression was also detected in the ASG chemosensory neurons in some transgenic lines. L1 animals show strong expression of hlh-29 in intestinal cells, and weaker expression in the rectal glands and the pharyngeal muscle cell PM1. By L3 stage, intestinal expression of the hlh-29::GFP is limited to the posterior intestinal cells, and PM1 expression is no longer detected. Expression is also detected in the ventral posterior coelomocytes in the later L3-stage larvae, and in the spermatheca and vulval muscles of L4 and adult animals.

• Primary Identifier: Expr4730
• Pattern: Intestine, rectal gland cells, head neurons.

• Primary Identifier: Expr4729
• Pattern: Intestine, rectal gland cells, head neurons including one in amphid, a phasmid neuron.

• Primary Identifier: Expr4721
• Pattern: Intestine, rectal gland cells.

• Primary Identifier: Expr4726
• Pattern: Intestine, rectal gland cells, head neurons.

• Primary Identifier: Expr4716
• Pattern: Intestine, rectal gland cells, head neurons.

• Primary Identifier: Expr4264
• Pattern: Expressed in body wall muscle cells, pharyngeal muscles, rectal gland cells, vulval and uterine muscles, and a subset of neurons in the head and ventral nerve cord. The expression was first detected in the embryo at the 1.5-fold stage and continued to be expressed until adulthood. In this stage, cells with position corresponding to P cells showed also GFP expression. In order to determine if the expression of GFP was in epidermal lineages, including P cells and their descendants, authors prepared double transgenic lines expressing GFP from promoter 1 of nhr-40 on the background of SU93 line that expresses an AJM::GFP membrane marker. This confirmed the expression of nhr-40::gfp in epidermal precursors P cells and their neuronal progeny within the ventral neuronal cord. However, the GFP was not observed in ventral epidermal cells that originated from P cells. The nhr-40::gfp was not observed in seam cells that are also marked by an AJM::GFP. The muscle pattern of expression was partially lost with truncations of this promoter fragments (-1013 and -682 bp); however, other aspects of expression were retained.

• Primary Identifier: Expr4646
• Pattern: Expression of TRPA-1:: GFP fusion proteins was observed in several cell types. In lines carrying the short fusion construct (for example, ljEx107), TRPA-1:: GFP fusion protein was localized to many tissues, including pharyngeal muscle and body wall muscle, the excretory system, the rectal gland cell, vulval epithelium, epithelial cells in the head, and the spermatheca. Sporadic expression was also observed in some head neurons with this construct.

• Primary Identifier: Expr4647
• Pattern: Transgenic lines generated with the partial protein fusion construct (for example, ljEx109) expressed TRPA-1:: GFP in the same cells as ljEx107 (see Expr4646), but with some additional cells, including the majority of amphid sensory neurons (for example, ASH, AWA, AWB, ASI and ASK) and the phasmid neurons PHA and PHB.

• Primary Identifier: Expr4648
• Pattern: Transgenic lines generated with the full-length protein fusion construct (for example, ljEx114) expressed TRPA-1:: GFP in the same cells as ljEx107 (see Expr4646), but with some additional cells, including the majority of amphid sensory neurons (for example, ASH, AWA, AWB, ASI and ASK) and the phasmid neurons PHA and PHB. The full-length TRPA-1:: GFP fusion was also expressed in the PVD and PDE in the postdeirid sensilla and the sensory neurons OLQ and IL1. Other neurons in the head and ventral nerve cord also expressed TRPA-1:: GFP.
• Subcellular Localization: The fusion protein was observed at the cilia of sensory neurons, as well as at the cell body.

• Primary Identifier: Expr5270
• Remark: Strain: BC11894
• Reporter Gene: [C15C8.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAGCAAAATCAAGAAAAATCCC] 3' and primer B 5' [AAGACGATCGAAGATCTGGAAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Larval Expression: intestine; rectal gland cells

• Primary Identifier: Expr5256
• Remark: Strain: BC15141
• Reporter Gene: [srr-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCCGCATCATCTTTTTC] 3' and primer B 5' [GGACTTGGAGTAATGATTGTTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr5242
• Remark: Also expressed in (comments from author) : unidentified cells in head, possibly neural Strain: BC13447
• Reporter Gene: [C11E4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCGAAGAAGGCAACA] 3' and primer B 5' [CAAAGTGCGATTTTCGTATCTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; unidentified cells in head; Larval Expression: pharynx; intestine; rectal gland cells; hypodermis; unidentified cells in head

• Primary Identifier: Expr5218
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16286
• Reporter Gene: [C09E7.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGAACTTCTCCTGTGCTCCC] 3' and primer B 5' [AGTCGTCGTCGATTTTTATCTGA] 3'.
• Pattern: Larval Expression: pharynx; intestine; rectal gland cells; unidentified cells in head

• Primary Identifier: Expr5208
• Remark: Strain: BC12550
• Reporter Gene: [C08C3.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTTTAAACGACCTGAAAGGAT] 3' and primer B 5' [GCGACGATTTTGAAGAGTTTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; Larval Expression: pharynx; arcade cells; pharyngeal-intestinal valve; intestine; rectal gland cells

• Primary Identifier: Expr5203
• Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. Strain: BC12754
• Reporter Gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5192
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15491
• Reporter Gene: [C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5186
• Remark: Strain: BC11648
• Reporter Gene: [nhr-50::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGAATATCAAGAGAGGGCGA] 3' and primer B 5' [GTAGATCAGCTGAAAGTGCAGAGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15051
• Reporter Gene: [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5160
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14877
• Reporter Gene: [gtl-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTCATTTTCCCGTGGTTTT] 3' and primer B 5' [CACGTTTTCTGTCCATTCAATTA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons

• Primary Identifier: Expr5161
• Remark: Strain: BC15652
• Reporter Gene: [C05C8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCAATTTTTGAAAAGAAAGAAAA] 3' and primer B 5' [TTTTACGTATGCTGATCTGAATTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5154
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11513
• Reporter Gene: [pld-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTAGTTTTGCATCCTTTTTGC] 3' and primer B 5' [TCTTCGCTCTCGATATTTCTGTC] 3'.
• Pattern: Adult Expression: pharynx; rectal gland cells; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5103
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15179
• Reporter Gene: [nhr-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCTTTCTCTAACTCTTTCGTC] 3' and primer B 5' [TGAAATGAAATAATGAATTGGAGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5497
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14162
• Reporter Gene: [C44C1.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACCCGACGACTAAACTATT] 3' and primer B 5' [TGTTAACTTTGCTATGATACCCGA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; rectal gland cells; unidentified cells in head

• Primary Identifier: Expr5486
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14917
• Reporter Gene: [C42C1.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCGATTCGGTATGAGTTG] 3' and primer B 5' [GAGACTGGAGTTGCCAATTATTTT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; tail neurons; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5473
• Remark: Strain: BC15639
• Reporter Gene: [C38H2.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGGTTACCTTTCTTGTTCAGA] 3' and primer B 5' [AACCGTCTCTTGATTTCTCATTTC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; spermatheca; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5436
• Remark: Also expressed in (comments from author) : unidentified cells in head, possibly arcade cells and other. Strain: BC12954
• Reporter Gene: [C35D10.14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTGTGGTAAGGGGCATGT] 3' and primer B 5' [TCTCTGATCATGAAAAGAATGAAT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; anal depressor muscle; unidentified cells in head; Larval Expression: intestine; rectal gland cells; anal depressor muscle; unidentified cells in head

• Primary Identifier: Expr5431
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail, neural. Strain: BC12994
• Reporter Gene: [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'.
• Pattern: Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5432
• Remark: Strain: BC14969
• Reporter Gene: [vav-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTGCCTCTCACTTCATACTCT] 3' and primer B 5' [GGCACCTGAAAATGCATTAAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; excretory cell; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; excretory cell; Nervous System; nerve ring; head neurons

• Primary Identifier: Expr5415
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13307
• Reporter Gene: [C34B2.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTCTTTCACCCCCAGTT] 3' and primer B 5' [TTGCGATTTCTAAAGCTGAAAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
The passageway in the hindgut between the posterior intestine, the rectal valve and the opening to the exterior.	rectum		WBbt:0005773
A variety of very different cell types which share cytoplasmic features (such as large membrane-bound granules) that suggest a role in secretion, thus termed gland cells.	gland cell		WBbt:0003670