WormMine: AnatomyTerm WBbt:0006753

• Definition: neuron of phasmid sensillum
• Name: phasmid neuron
• Primary Identifier: WBbt:0006753

2 Children

Definition	Name	Synonym	Primary Identifier
Neuron class of two phasmid neurons, type B.	PHB		WBbt:0007808
Neuron class of two phasmid neurons, type A.	PHA		WBbt:0007807

4 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Enriched in phasmids (adult), phasmids (larva), amphids (adult), amphids (larva), dorsal nerve cord (larva).		WBPaper00029359_1194
	Enriched in phasmids (adult), phasmids (larva), dorsal nerve cord (adult), amphids (adult), amphids (larva).		WBPaper00029359_1240
	Enriched in phasmids (adult), phasmids (larva).		WBPaper00029359_1243
	Enriched in phasmids (adult), phasmids (larva).		WBPaper00029359_1336

229 Expression Patterns

• Primary Identifier: Expr4685
• Remark: Reporter gene fusion type not specified.
• Pattern: ifta-2 was expressed exclusively in ciliated sensory neurons in both the head and the tail of the adult hermaphrodite. No expression was observed outside of these neurons.

• Primary Identifier: Expr4686
• Remark: Furthermore, analysis of the RabL5 homolog in mouse renal epithelium indicates that it also localizes to the primary cilium raising the possibility of conserved function.
• Subcellular Localization: FTA-2::GFP is present at the base of cilia and within the cilia axoneme of the ciliated amphid and phasmid sensory neurons in the adult hermaphrodite. FTA-2::GFP can also be detected moving along the cilium axoneme.

• Primary Identifier: Expr4729
• Pattern: Intestine, rectal gland cells, head neurons including one in amphid, a phasmid neuron.

• Primary Identifier: Expr4715
• Pattern: Intestine, head neurons including one in amphid, two phasmid neurons.

• Primary Identifier: Expr4408
• Remark: No detailed description on cellular expression pattern in other tissue or life stage.
• Pattern: Expressed in amphid and phasmid neurons.

• Primary Identifier: Expr4214
• Pattern: Expression was detected in most ciliated sensory neurons in the hermaphrodite. There was no expression evident in non-ciliated cell types.

• Primary Identifier: Expr4215
• Pattern: Expression was detected in most ciliated sensory neurons in the hermaphrodite. There was no expression evident in non-ciliated cell types. nph-4 expressed in a subset of ciliated sensory neurons in the head of the worm as well as in most of the phasmid neurons in the tail.

• Primary Identifier: Expr4591
• Pattern: The full-length dyf-5::gfp construct showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr4592
• Pattern: The full-length dyf-5::gfp construct (see Expr4591) showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail. The dyf-5ex4::gfp fusion construct essentially showed the same dyf-5 expression pattern, albeit stronger and more restricted to the cell bodies. In addition, DYF-5ex4::GFP could be detected in the CAN cells, neurons associated with the excretory canal and in a pair of neurons in the posterior lateral ganglion.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr4635
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4636
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4637
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4638
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4639
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4523
• Pattern: Expression of DYF-6::GFP is restricted to a few cells from hatching to adulthood. Of particular note, DYF-6::GFP is consistently expressed in the cell bodies, dendritic bodies, and dendritic endings of the phasmid neurons. Expression was also very evident in the dendritic bodies and endings of the amphid sensilla. DYF-6::GFP was faintly and irregularly expressed in the cell bodies of the dye-filling amphid neurons. Expression of DYF-6::GFP was also seen in the hypodermis and in several neuronal cell bodies in the region of the inner labial cell bodies. Finally, expression can be seen in a lateral neuronal cell body in the region of the PDE cell body in older larvae and adults.
• Subcellular Localization: DYF-6::GFP was also expressed in the cell and dendritic bodies of the phasmid neurons in the six dauer larvae (the dendritic bodies were often kinked, as though their linearity had been affected by shrinkage of the body during formation of the dauer state). In four of the animals, DYF-6::GFP indicated that the phasmid neurons had proper dendritic endings, and IFT of the GFP could be easily seen in the endings. In the other two animals, however, DYF-6::GFP did not provide evidence for the existence of dendritic endings for the phasmid neurons, indicating that the endings might occasionally be severely retracted or modified in dauer larvae. For both the amphid and phasmid neurons, the greatest intensity of DYF-6::GFP was in the transition zone between the dendritic bodies and their ciliary endings. Of particular note, anterograde and, to a lesser extent, retrograde movement of GFP particles could be seen along the length of the dendritic endings of both the amphid and phasmid neurons. In the amphid neurons, the particles moved in the anterograde direction over the combined middle and distal segments of the ciliary axoneme at 0.9 +/- 0.1 m/sec. IFT could be seen prior to hatching and throughout postembryonic development and adulthood. IFT of DYF-6::GFP in dauer larvae: Six dauer larvae from SP2730 were picked from plates exhausted of bacteria to NGM plates without bacteria, followed by a further incubation of 3 days. DYF-6::GFP was expressed in the cell bodies and in the dendritic bodies and endings of the dye-filling amphid neurons. Moreover, IFT could be easily seen in the dendritic endings, but there appeared to be fewer GFP particles undergoing IFT in the amphid bundles relative to that seen in non-dauer animals.

• Primary Identifier: Expr5159
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14904
• Reporter Gene: [C05C10.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTATTGTTGCCATGAGTCATAA] 3' and primer B 5' [AGACCGTCATCTGCCATTATCT] 3'.
• Pattern: Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; tail neurons; phasmids

• Primary Identifier: Expr5143
• Remark: Also expressed in (comments from author) : Expression in 2 non-DiI stained head neuron pairs between anterior and posterior pharyngeal bulbs, sending dendrites to tip of nose (Hober Lab apr 2005). Strain: BC15142
• Reporter Gene: [srd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTCTTTTTCTATCGACGAGC] 3' and primer B 5' [TCTTGTGCGATTCTGACAAATTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; Nervous System; head neurons; tail neurons; phasmids; Larval Expression: intestine; Reproductive System; Nervous System; head neurons; tail neurons; phasmids; unidentified cells in body

• Primary Identifier: Expr5146
• Remark: Strain: BC15143
• Reporter Gene: [srh-79::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATGCAATCACAGAAAACCT] 3' and primer B 5' [GATAAGAGATCACTCGAACAACGA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5116
• Remark: Also expressed in (comments from author) : Other head and tail neurons besides amphids and phasmids Strain: BC13146
• Reporter Gene: [C02H7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCAAATCAATAGAGGGAGAGA] 3' and primer B 5' [CAACGCTGATCGCACTTTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5115
• Remark: Strain: BC13585
• Reporter Gene: [C02H7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCAAATCAATAGAGGGAGAGA] 3' and primer B 5' [CAACGCTGATCGCACTTTT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5482
• Remark: Also expressed in (comments from author) : Strain not available. Strain: BC10855
• Reporter Gene: [eif-3.H::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGGGTTTTACCTCCAAAGAA] 3' and primer B 5' [GCTGTCGAGATTTTTGATAACC] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; Nervous System; head neurons; tail neurons; phasmids; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons; tail neurons; phasmids

• Primary Identifier: Expr5465
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15047
• Reporter Gene: [nex-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATAGAGTGAGGGTGTTTGGAAG] 3' and primer B 5' [TACATTTGGAAAATGATTGGAATG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5447
• Remark: Strain: BC14777
• Reporter Gene: [srab-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATGCCGATCAAAATGTG] 3' and primer B 5' [CTCTTGGCAGTGATCCTGGT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5449
• Remark: Also expressed in (comments from author) : ASH amphid neuron; PHA + PHB phasmid neurons. (Stein Lab 2005). Strain: BC14832
• Reporter Gene: [srab-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTTCACAACCTGACGTCTTT] 3' and primer B 5' [ATCGTTTGACAGTTTTCCTGGTA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5445
• Remark: Also expressed in (comments from author) : ADL, ASH, ASI, ASJ, + ASK amphid neurons; PHA + PHB phasmid neurons. Amphid neurons are variable among worms except ASJ (Stein Lab 2005). Strain: BC14734
• Reporter Gene: [srab-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCCGCTAGTGACGTATCA] 3' and primer B 5' [AAGAGATCTGGAACGGGGTT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5523
• Remark: Also expressed in (comments from author) : IL1 + IL2 labial neurons (Thomas Lab 2005). Good expression. Strain: BC12597
• Reporter Gene: [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr5515
• Remark: Also expressed in (comments from author) : Expression is is seen from L3 stage and onward Strain: BC16049
• Reporter Gene: [srx-110::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCAGGTGAAACTGGATCG] 3' and primer B 5' [AGTTACTCAAAAACATGGAAGTGA] 3'.
• Pattern: Adult Expression: Nervous System; tail neurons; phasmids; Larval Expression: Nervous System; tail neurons; phasmids

• Primary Identifier: Expr5395
• Remark: Also expressed in (comments from author) : ASG, ASH, + ASI amphid neurons; PHB phasmid neuron. PHB is bright and reproducible. Amphid neuron are all faint and unreliable. (Bargmann Lab 2005) Strain: BC14770
• Reporter Gene: [srxa-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCACTTCCAAGTACGGAAATACA] 3' and primer B 5' [GGAATGTGCTCAAAGATATTGATT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr5383
• Remark: Strain: DM12665
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5360
• Remark: Strain: BC12286
• Reporter Gene: [C27D6.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGAGAACTGAAATCGCACATAAC] 3' and primer B 5' [CATTTGTTTCTAGGATTTGATGA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
neuron type, neurons that have ciliated nerve endings.	ciliated neuron		WBbt:0006816
bilateral sensory organ in the tail, similar to the amphid in the head.	phasmid sensillum		WBbt:0005425