WormMine: AnatomyTerm WBbt:0005394

• Definition: neuron of the amphid sensillum
• Name: amphid neuron
• Primary Identifier: WBbt:0005394
• Synonym: amphid sensory neuron

13 Children

Definition	Name	Synonym	Primary Identifier
Neuronal process of an amphid neuron.	amphid process		WBbt:0005393
Neuron class of two ciliated neurons that are part of the amphid sensilla; the endings are in the amphid channel, which is open to the outside.	ASH		WBbt:0005665
Neuron class of two neurons that have dual ciliated endings in the amphid sensillum. The endings are in the amphid channel, which is open to the outside. Processes from lateral cell bodies enter the ventral cord via the amphidial commissures and turn anteriorly to enter the nerve ring. The processes of ADF run near the outside surface and posterior face of the ring, in close association with those of AIZ. They meet at the dorsal mid-line and terminate; there is a gap junction at the point or contact. The main synaptic output is to RIA and AIZ; there are also synapses to SMB, AUA and RIR, usually in dyadic combinations with RIA or AIZ. AWB synapses onto ADF in several places, and there are gap junctions to RIH, ADA and AIA.	ADF		WBbt:0005660
Neuron class of two ciliated neurons with large, flattened, sheet-like endings that are associated with the sheath cells of the amphid sensilla.	AWC		WBbt:0005672
Neuron class of two ciliated neurons that are associated with the sheath cells of the amphid sensilla.	AWA		WBbt:0005670
Neuron class of two ciliated neurons with flattened, sheet-like endings that are associated with the sheath cells of the amphid sensilla	AWB		WBbt:0005671
Neuron class of two neurons that have dual ciliated endings in the amphid sensillum; the endings are in the amphid channel, which is open to the outside.	ADL		WBbt:0005661
Neuron class of two ciliated neurons that are part of the amphid sensillum; the endings of AFD have numerous villi, which poke into the amphid sheath cells.	AFD		WBbt:0005662
Neuron class of two ciliated neurons that are part of the amphid sensilla; the endings are in the amphid channel, which is open to the outside.	ASI		WBbt:0005666
Neuron class of two ciliated neurons that are part of the amphid sensilla; the endings are in the amphid channel, which is open to the outside	ASE		WBbt:0005663
Neuron class of two ciliated neurons that are part of the amphid sensilla; the endings are in the amphid channel, which is open to the outside.	ASG		WBbt:0005664
Neuron class of two ciliated neurons that are part of the amphid sensilla. The endings are in the amphid channel, which is open to the outside.	ASJ		WBbt:0005667
Neuron class of two ciliated neurons that are part of the amphid sensilla. The endings are in the amphid channel, which is open to the outside.	ASK		WBbt:0005668

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Enriched in phasmids (adult), phasmids (larva), amphids (adult), amphids (larva), dorsal nerve cord (larva).		WBPaper00029359_1194
	Enriched in phasmids (adult), phasmids (larva), dorsal nerve cord (adult), amphids (adult), amphids (larva).		WBPaper00029359_1240

422 Expression Patterns

• Primary Identifier: Expr4685
• Remark: Reporter gene fusion type not specified.
• Pattern: ifta-2 was expressed exclusively in ciliated sensory neurons in both the head and the tail of the adult hermaphrodite. No expression was observed outside of these neurons.

• Primary Identifier: Expr4686
• Remark: Furthermore, analysis of the RabL5 homolog in mouse renal epithelium indicates that it also localizes to the primary cilium raising the possibility of conserved function.
• Subcellular Localization: FTA-2::GFP is present at the base of cilia and within the cilia axoneme of the ciliated amphid and phasmid sensory neurons in the adult hermaphrodite. FTA-2::GFP can also be detected moving along the cilium axoneme.

• Primary Identifier: Expr4755
• Pattern: frh-1::gfp1 showed a complex expression pattern, which includes a number of neurons in the head. This construct also stains the muscle cells of the pharynx, intestinal cells, body wall muscle cells and spermatheca. This construct was expressed in neurons that showed dendritic projections toward the mouth, suggesting that they may be sensory amphidic neurons. Costaining with DiI, which stains amphidic neurons in C. elegans, confirmed the amphidic nature of these cells.

• Primary Identifier: Expr4756
• Pattern: frh-1::gfp2, which contains a smaller fragment (670 bp) upstream of frh-1 and the gene itself, was only expressed in amphid neurons.

• Primary Identifier: Expr4729
• Pattern: Intestine, rectal gland cells, head neurons including one in amphid, a phasmid neuron.

• Primary Identifier: Expr4720
• Pattern: Intestine, weak pharyngeal lumen, head neurons including one in amphid.

• Primary Identifier: Expr4715
• Pattern: Intestine, head neurons including one in amphid, two phasmid neurons.

• Primary Identifier: Expr4408
• Remark: No detailed description on cellular expression pattern in other tissue or life stage.
• Pattern: Expressed in amphid and phasmid neurons.

• Primary Identifier: Expr4260
• Remark: More detailed studies are required to identify the cellular domains in which STIM-1::GFP is expressed. It should be noted here that the absence of detectable STIM-1::GFP expression in tissues other than those shown does not rule out a functional role for STIM-1 in other cell types. The 1.9-kb stim-1 promoter used in these studies may lack regulatory information required for cell-specific expression. In addition, STIM-1::GFP expression levels may be below detection levels in other tissues. More definitive identification of STIM-1 expression sites awaits the development of suitable antibodies for immunolocalization.
• Pattern: Prominent expression of STIM-1::GFP was detected in the spermatheca, gonad sheath cells, the intestine, and neurons in the head. Expression was also detected in uterine epithelial cells. STIM-1::GFP-expressing head neurons are likely amphid and/or inner labial (IL) neurons. Expression of STIM-1::GFP in the intestine was heterogeneous. The anterior and posterior intestine expressed the reporter very strongly while expression was weaker in the midsection.
• Subcellular Localization: Intestinal STIM-1::GFP appeared to be localized to membrane and submembrane regions. Confocal Z-sections also revealed a prominent punctate localization in the anterior intestine and sheath cells. STIM-1::GFP expression showed a striking localization to a reticular structure in the posterior intestine. This reticular structure resembles the ER of C. elegans intestinal cells.

• Primary Identifier: Expr4244
• Pattern: ser-1::gfp expression was observed in the pharyngeal muscles. In addition, ser-1::gfp expression was observed in the vulval muscles, as well as in many neurons. ser-1::gfp is not detectable in HSN or VC.

• Primary Identifier: Expr4214
• Pattern: Expression was detected in most ciliated sensory neurons in the hermaphrodite. There was no expression evident in non-ciliated cell types.

• Primary Identifier: Expr4215
• Pattern: Expression was detected in most ciliated sensory neurons in the hermaphrodite. There was no expression evident in non-ciliated cell types. nph-4 expressed in a subset of ciliated sensory neurons in the head of the worm as well as in most of the phasmid neurons in the tail.

• Primary Identifier: Expr4591
• Pattern: The full-length dyf-5::gfp construct showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr4592
• Pattern: The full-length dyf-5::gfp construct (see Expr4591) showed weak GFP expression in many neurons in the head, including amphid and labial sensory neurons and three pairs of neurons in the tail, including the phasmid sensory neurons. In addition, expression was observed in many cells in the male tail. The dyf-5ex4::gfp fusion construct essentially showed the same dyf-5 expression pattern, albeit stronger and more restricted to the cell bodies. In addition, DYF-5ex4::GFP could be detected in the CAN cells, neurons associated with the excretory canal and in a pair of neurons in the posterior lateral ganglion.
• Subcellular Localization: This DYF-5::GFP fusion could be detected uniformly in axons, cell bodies, and dendrites. In addition, authors observed strong fluorescence at the transition zones, which connect the cilia with the dendrites, and weak fluorescence uniformly in the cilia.

• Primary Identifier: Expr4635
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4636
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4637
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4638
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4639
• Pattern: Expressed exclusively within ciliated cells.

• Primary Identifier: Expr4615
• Pattern: Expressed in: intestine, amphid.

• Primary Identifier: Expr4616
• Remark: Species: C. briggsae.
• Pattern: In C. briggsae, the gene expressed in: intestine, amphid.

• Primary Identifier: Expr4617
• Pattern: In C. briggsae, the gene expressed in: intestine, amphid.

• Primary Identifier: Expr4523
• Pattern: Expression of DYF-6::GFP is restricted to a few cells from hatching to adulthood. Of particular note, DYF-6::GFP is consistently expressed in the cell bodies, dendritic bodies, and dendritic endings of the phasmid neurons. Expression was also very evident in the dendritic bodies and endings of the amphid sensilla. DYF-6::GFP was faintly and irregularly expressed in the cell bodies of the dye-filling amphid neurons. Expression of DYF-6::GFP was also seen in the hypodermis and in several neuronal cell bodies in the region of the inner labial cell bodies. Finally, expression can be seen in a lateral neuronal cell body in the region of the PDE cell body in older larvae and adults.
• Subcellular Localization: DYF-6::GFP was also expressed in the cell and dendritic bodies of the phasmid neurons in the six dauer larvae (the dendritic bodies were often kinked, as though their linearity had been affected by shrinkage of the body during formation of the dauer state). In four of the animals, DYF-6::GFP indicated that the phasmid neurons had proper dendritic endings, and IFT of the GFP could be easily seen in the endings. In the other two animals, however, DYF-6::GFP did not provide evidence for the existence of dendritic endings for the phasmid neurons, indicating that the endings might occasionally be severely retracted or modified in dauer larvae. For both the amphid and phasmid neurons, the greatest intensity of DYF-6::GFP was in the transition zone between the dendritic bodies and their ciliary endings. Of particular note, anterograde and, to a lesser extent, retrograde movement of GFP particles could be seen along the length of the dendritic endings of both the amphid and phasmid neurons. In the amphid neurons, the particles moved in the anterograde direction over the combined middle and distal segments of the ciliary axoneme at 0.9 +/- 0.1 m/sec. IFT could be seen prior to hatching and throughout postembryonic development and adulthood. IFT of DYF-6::GFP in dauer larvae: Six dauer larvae from SP2730 were picked from plates exhausted of bacteria to NGM plates without bacteria, followed by a further incubation of 3 days. DYF-6::GFP was expressed in the cell bodies and in the dendritic bodies and endings of the dye-filling amphid neurons. Moreover, IFT could be easily seen in the dendritic endings, but there appeared to be fewer GFP particles undergoing IFT in the amphid bundles relative to that seen in non-dauer animals.

• Primary Identifier: Expr5276
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14096
• Reporter Gene: [C16C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; amphids; unidentified cells in tail

• Primary Identifier: Expr5277
• Remark: Strain: BC15643
• Reporter Gene: [tag-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; amphids; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; seam cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5198
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15173
• Reporter Gene: [C07E3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCTTGCTCATGTTCCCAAGT] 3' and primer B 5' [TCTGGTTAAGCGTGTTCGAGTA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; Larval Expression: Nervous System; head neurons; amphids; tail neurons

• Primary Identifier: Expr5179
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15290
• Reporter Gene: [srj-24::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGGGAAGTTTTCAGAACG] 3' and primer B 5' [ACTTGTGTGGATTTTTACAGCGT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; Larval Expression: intestine; Nervous System; head neurons; amphids

• Primary Identifier: Expr5161
• Remark: Strain: BC15652
• Reporter Gene: [C05C8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCAATTTTTGAAAAGAAAGAAAA] 3' and primer B 5' [TTTTACGTATGCTGATCTGAATTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5146
• Remark: Strain: BC15143
• Reporter Gene: [srh-79::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATGCAATCACAGAAAACCT] 3' and primer B 5' [GATAAGAGATCACTCGAACAACGA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5116
• Remark: Also expressed in (comments from author) : Other head and tail neurons besides amphids and phasmids Strain: BC13146
• Reporter Gene: [C02H7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCAAATCAATAGAGGGAGAGA] 3' and primer B 5' [CAACGCTGATCGCACTTTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
neuron type, neurons that have ciliated nerve endings.	ciliated neuron		WBbt:0006816
Bilaterally symmetric chemosensory specializations located on the two lateral lips in the head involving a large hole in the anterior cuticle.	amphid sensillum	amphid	WBbt:0005391