|
Reporter gene fusion type not specified. |
|
Expr4789
|
The glt-4::GFP reporter is expressed strongly in the metacorpus region of the pharynx and in a few head neurons. glt-4 is not expressed in the postsynaptic command interneurons. |
|
|
|
|
Expr4437
|
Expressed in the seam cells from L1 to adult. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. Expressed in the pro- and metacorpus and isthmus. |
|
|
|
|
Expr11526
|
CYP33E2 promoter-driven expression of GFP occurred exclusively in the pharynx and, not visible in each individual, in the pharyngeal-intestinal valve of the nematodes. This type of strong pharynx-restricted expression was observed throughout larval development and in adult nematodes. Expression was most prominent in the pharyngeal pro- and meta-corpus. Confocal imaging suggested marginal, muscle, and/or epithelial cells as the major expression sites of the pCYP33E2::GFP construct within the pharynx. Radially, only marginal cell types are continuously organized with three-fold symmetry around the pharyngeal lumen. Imaginary cross sections derived from confocal imaging series of the pro- and meta-corpus indicated that the GFP reporter was expressed in the three marginal mc1 cells, but not in the pm3 and pm4 muscle cells. A further labelling of the mc2 and mc3 marginal cells in the isthmus and terminal bulb becomes then visible. Expression was observed in finger-like fluorescent structures that represent the interlocking extensions that hold marginal cells to muscles. Furthermore, an expression of pCYP33E2::GFP also in the epithelial e1, e2, and e3 cells seems most likely. Fluorescence might also correspond to pm2 muscle cells. |
|
|
|
|
Expr11170
|
nasp-1::GFP was localized primarily in the pharynx. Expression was seen in the metacorpus and terminal bulb of the pharynx with clear intracellular localization. |
|
|
A 5' region of merely 470 bp (construct pPHA2::GFP-B) or even 158 bp (construct pPHA2::GFP-C) upstream of the pha-2 gene is sufficient to support weak PHA2::GFP expression in some cells of the pharyngeal primordium and some cells of the adult metacorpus, and strong expression in extrapharyngeal head cells, intestinal and rectal cells. However, these two constructs fail to rescue the pha-2 mutant and show no PHA2::GFP expression in the following pharyngeal cells, the pm5 muscles, the I4 interneuron, and the pharyngeal epithelial cells, indicating that expression of pha-2 in pharyngeal cells is essential for rescue. |
|
Expr11835
|
|
|
|
|
|
Expr13901
|
Prib-1::gfp is broadly expressed in ectodermal and mesodermal cells during embryogenesis. A salient feature of the rib-1 expression pattern is that it is very dynamic in hypodermal cells during development. In embryogenesis, Prib-1::gfp is detected along the entire layer of hypodermoblasts that surrounds the gastrulating embryo at about 200 minutes after fertilization. By the early comma stage of embryogenesis, Prib-1::gfp is expressed at high levels in hypodermal cells of the elongating embryo, including hypodermal cells extending ventrally during ventral closure and in the two rows of dorsal hypodermal cells undergoing dorsal intercalation. Following these embryonic morphogenetic events, expression of Prib-1::gfp in the hypodermal cells of the body wall is no longer visible during larval and adult stages, except for seam cells undergoing fusion during larval development. Also, hypodermal cells of the developing vulva express Prib-1::gfp, at a low expression level in L3 larvae and at a stronger level in L4 larvae and just molted young adults, and vanishing in vulval cells in the adult. The nervous and digestive systems express Prib-1::gfp stably and continuously from embryogenesis throughout adulthood. Strong and sustained expression is seen in motorneurons, interneurons, sensory neurons (including AVM), neurons in the head and tail ganglia, with the GFP signal filling axons running along the ventral and dorsal nerve cords, commissures, and sublaterals. Expression in neurons of the ventral nerve cord and of the head ganglia is visible in 1.5-, 2-, and 3-fold embryos, and persists into adulthood. Strong expression of Prib-1::gfp is also observed in the pharynx from the 2-fold stage of embryogenesis onwards and remained strong in adults (procorpus, metacorpus, terminal bulb, grinder, and pharyngeal-intestinal valve). The anal depressor, the anal sphincter, the two enteric muscles, the spermathecae and the uterine muscles maintain expression in adults. |
|
|
Clone: pUL#IAH1G4 |
|
Expr7498
|
4 of 8 lines showed expression in metacorpus and terminal bulb of the pharynx, late embryogenesis to adult. (Other 4 lines showed no expression.) Terminal bulb expression was stronger. UL2417 and UL2419 look integrated. Occasionally a single cell in the nerve ring showed expression. |
|
|
Clone: pUL#JRH/AE09 |
|
Expr7416
|
From late embryo to adult can see strong expression in the procorpus and metacorpus of the pharynx as well as four cells within the terminal bulb (which may be muscle cells). Post hatching (and possibly in late embryos) can see expression in tail in the muscles linked to the rectum. Vulval-related expression is also observed as cells either side of the forming vulva in larval stages and in only the very external cells of the opening in adult stages. |
|
|
Other strain-- UL481. Legacy Data: "Bauer PK" "Mounsey A" "McCarroll D" "Hope IA"Date 1998-12. late embryo(author) = 3-fold embryo(curator). |
|
Expr112
|
This neuronal pattern gives expression throughout all life stages of C. elegans. Staining is first seen in precomma stage embryos. In 3-fold embryos expression appears to be localised in nuclei around the pharynx and tail. In young larvae there is extensive staining in all of the head ganglia and the anal ganglion. The ventral nerve cord and its cell bodies also show strong expression. As the worm ages the expression in the head ganglia is reduced to a number of nuclei in the ventral (ie AIML/R?) and lateral ganglion, although expression in the nerve ring and the ventral nerve cord is still observed. There appears to be some mosaicism in the expression as some larvae show stronger staining in the ventral nerve cord and more nuclei stain in the head ganglia, whereas in other larvae head expression is reduced and only the cell bodies of the ventral nerve cord stain. Diffuse expression is sometimes observed in the metacorpus and terminal bulb of the pharynx in larvae and adults. |
|
|
|
|
Expr3055
|
The CeENT1-GFP fusion protein was produced throughout the life cycle, from late embryo stage through the larval stages to the adult, but only in a limited number of cell types. The CeENT1-GFP fusion protein was particularly abundant in the pharyngeal musculature, notably in the terminal bulb and procorpus. The fusion protein was also strongly evident in all of the intestinal cells both of larvae and adults. |
Fluorescence was most marked at the cell surfaces, suggesting that the fusion protein was correctly inserted and targeted to the plasma membranes. |
|
|
|
Expr3056
|
The CeENT2 fusion protein showed a temporal and spatial pattern of expression very similar to that of ZK809.4::GFP (see Expr3055). The chief difference was that the CeENT2-GFP fusion protein was more abundant in the isthmus and metacorpus regions of the pharynx than the CeENT1-GFP fusion protein. |
Fluorescence was most marked at the cell surfaces, suggesting that the fusion protein was correctly inserted and targeted to the plasma membranes. |
|
|
|
Expr11156
|
ncx-2 is expressed in pharyngeal muscle including procorpus, metacorpus, isthmus and terminal bulb, body wall muscle, enteric muscle, and vulval muscle. |
|
|
|
|
Expr11162
|
ncx-8 is strongly expressed in the pharyngeal muscle including procorpus, metacorpus, isthmus andterminal bulb, and in the intestine. |
|
|
|
|
Expr11043
|
F48A11.1 was expressed specifically in the period immediately preceding each moult. Expression appeared limited to the pharynx and specifically to the glandular cells g1 and g2 (5 nuclei) in the terminal bulb, the three m4 myo-epithelial cells (6 nuclei) in the metacorpus and the three m3 myo-epithelial cells (6 nuclei) in the pro- corpus. No GFP was detected elsewhere in transgenic nematodes despite careful examination of the reproductive tissues and intestine. |
|
|
|
|
Expr3025
|
The iri-1::gfp is expressed in the terminal bulb of the pharynx, amphid socket cells, pharyngeal-intestinal valve, intestine, excretory cell, rectal epithelial cells, and vulva hypodermis. In addition, iri-1::gfp is expressed in the corpus of the pharynx, the pharyngeal neuron I3, the anal sphincter and in the gonad precursor cells Z1 and Z4. |
|
|
|
The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. |
Expr9566
|
Expression is evident in both the metacorpus and terminal bulb of the adult pharynx. B-gal staining seems to be sub-cellularly localised in the pseudocircular m4 muscle cells in the metacorpus; staining in the terminal bulb is restricted to the posterior of the bulb, and so may mark the location of the m7 muscles. |
Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other |
|
|
|
Expr11836
|
When the 2.7-kb promoter is present to drive a truncated pha-2 gene containing only the first three exons and first two introns, the complete pharyngeal expression profile of the full-length rescue-competent pPHA2::GFP-A construct is restored (pPHA2::GFP-E). This construct also supports expression in rectal gland cells, but shows no expression in the head neurons or intestine. This shows that important regulatory sequences exist within the first two introns and that these elements operate in concert with 5' sequences that are in the 500 to 2700 bp to drive robust expression of pha-2 in the pm5, I4, metacorpus cells, and pharyngeal epithelial cells. |
|
|
|
|
Expr11837
|
The pPHA2::GFP-D construct, which contains the third intron as well as part of the fourth exon, exhibited an expression profile similar to the pPHA2::GFP-E construct (Expr11836). |
|
|
|
|
Expr9410
|
Diffuse expression is seen in the anterior pharynx (procorpus and metacorpus) from the 3-fold embryo stage until adulthood. Occasionally more general staining throughout the pharynx is seen. |
Sub-cellular localization within the body wall muscle: Sarcoplasmic reticulum (SR)-like |
|
Strain UL1990, UL2564 |
|
Expr13586
|
Expression begins in the metacorpus of the pharynx of late embryos and carries on through larval and adult stages. Faint intestinal, bodywall muscle and very strong tail expression, possibly the intestinal-rectal valve, in larvae and adults. |
|
