WormMine: AnatomyTerm WBbt:0005175

• Definition: organ producing either sperm or ova.
• Name: gonad
• Primary Identifier: WBbt:0005175

4 Children

Definition	Name	Synonym	Primary Identifier
somatic cell that situates at the tip of a gonad arm.	distal tip cell	DTC	WBbt:0006865
The components of the gonad that are separate from the germline proper. In hermaphrodite, these include five tissues which are all derived from the somatic primordium : the distal tip cells, the gonadal sheath, the spermatheca, the spermatheca-uterine valve (sp-ut) and the uterus.	somatic gonad	somatic germline	WBbt:0005785
organ in hermaphrodite animal that produces both ova and sperm.	hermaphrodite gonad	ovotestis	WBbt:0005178
gonad of a male animal, produces sperm.	male gonad		WBbt:0006794

25 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in pie-1(ne4443[PIE-1-Degron-GFP])	DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05.	WBPaper00061478:pie-1(ne4433)_upregulated
	Transcripts that showed significantly increased expression in hda-1[KKRR] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4747)_upregulated
	Transcripts that showed significantly increased expression in hda-1[KKRR]-smo-1 in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4748)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in prg-1(tm872) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:prg-1(tm872)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Transcripts that showed significantly increased expression in sin-3(syb2172) comparing to in N2 gonads at young adult stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066085:sin-3(syb2172)_upregulated
	Transcripts that showed significantly increased expression in hrde-1(tm1200) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hrde-1(tm1200)_upregulated
	Genes down regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_downregulated
	Transcripts that showed significantly increased expression in hda-3(ok1991) comparing to in N2 gonads at young adult stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066085:hda-3(ok1991)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(syb2172) comparing to in N2 gonads at young adult stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066085:sin-3(syb2172)_downregulated
	mRNAs significantly downregulated >1.3 fold in henn-1(pk2295) gonads comparing to in N2 gonads 68 - 70 hours after L1 larva stage.	Differential expression analysis, including fold change and p value calculation, was done using DESeq2 v.1.18.1 with the Benjamin Hochberg multiple test correction applied (FDR = 0.05).	WBPaper00058942:henn-1(pk2295)_downregulated
	Transcripts that showed significantly decreased expression in hda-3(ok1991) comparing to in N2 gonads at young adult stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066085:hda-3(ok1991)_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 gonads at young adult stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066085:sin-3(tm1276)_downregulated
	Transcripts that showed significantly decreased expression in the dissected gonads of gld-2(q492) gld-1(q485) (I); glp-1(ar202)(III) (glp-1(gf) NOTCH ON), comparing to in the dissected gonads of gld-2(q492) gld-1(q485) (I); glp-1(e2144) (glp-1(lf) NOTCH OFF)	Fold change > 2.	WBPaper00050094:glp-1(gf)_downregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 gonads at young adult stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066085:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in the dissected gonads of mes-2(bn11) unc-4(e120)(II), comparing to in the dissected gonads of unc-4(e120)(II)	Fold change > 2.	WBPaper00050094:mes-2(bn11)_downregulated
	Transcripts that showed significantly decreased expression in the dissected gonads of mes-6(bn66) dpy-20(e1282)(IV), comparing to in the dissected gonads of dpy-20(e1282)(IV)	Fold change > 2.	WBPaper00050094:mes-6(bn66)_downregulated
	mRNAs significantly upregulated >1.3 fold in henn-1(pk2295) gonads comparing to in N2 gonads 68 - 70 hours after L1 larva stage.	Differential expression analysis, including fold change and p value calculation, was done using DESeq2 v.1.18.1 with the Benjamin Hochberg multiple test correction applied (FDR = 0.05).	WBPaper00058942:henn-1(pk2295)_upregulated
	Transcripts that showed significantly increased expression in the dissected gonads of gld-2(q492) gld-1(q485) (I); glp-1(ar202)(III) (glp-1(gf) NOTCH ON), comparing to in the dissected gonads of gld-2(q492) gld-1(q485) (I); glp-1(e2144) (glp-1(lf) NOTCH OFF)	Fold change > 2.	WBPaper00050094:glp-1(gf)_upregulated
	Transcripts that showed significantly increased expression in the dissected gonads of mes-2(bn11) unc-4(e120)(II), comparing to in the dissected gonads of unc-4(e120)(II)	Fold change > 2.	WBPaper00050094:mes-2(bn11)_upregulated
	Transcripts that showed significantly increased expression in the dissected gonads of mes-6(bn66) dpy-20(e1282)(IV), comparing to in the dissected gonads of dpy-20(e1282)(IV)	Fold change > 2.	WBPaper00050094:mes-6(bn66)_upregulated
	Transcripts that showed significantly increased expression in pie-1(ne4303[PIE-1(K68R)])	DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05.	WBPaper00061478:pie-1(ne4303)_upregulated

382 Expression Patterns

• Primary Identifier: Expr4712
• Pattern: In young adult hermaphrodites, spas-1 was expressed in the whole bodies, particularly intestine, gonad, and vulva.

• Primary Identifier: Expr4412
• Pattern: In wild type animals, detectable expression of pzf-1 was limited to the bend and proximal region of the gonad.

• Primary Identifier: Expr4413
• Pattern: In wild type animals, detectable expression of sea-1 was limited to the bend and proximal region of the gonad

• Primary Identifier: Expr4414
• Pattern: In wild type animals, detectable expression of hlh-2 was limited to the bend and proximal region of the gonad

• Primary Identifier: Expr4403
• Pattern: Strong and consistent expression was observed in a limited number of neurons in the head and tail and coelomocytes. Weaker and/or inconsistent expression of TTX-7::EGFP was detected in nerve cord motor neurons, intestine, and somatic gonad. The head neurons expressing ttx-7::EGFP include AFD and RIA neurons. Also expressed in ASH, ASE, ASJ, AWC, ADF, ADL, ASI, ASK, AWB, VNC motor neurons, etc.
• Subcellular Localization: TTX-7::EGFP was diffusely expressed in the cytoplasm and was not localized to any specific subcellular compartment.

• Primary Identifier: Expr4574
• Pattern: In wild-type animals, sax-7 is expressed in multiple tissues with robust SAX-7 accumulation in the nervous system. Expression was detected in pharynx, gonad, and the nerve ring and ventral nerve cord.

• Primary Identifier: Expr4660
• Subcellular Localization: Wild-type MIG-17-GFP localized to the surface of the gonad and the intestine, whereas MIG-17(D79N)-GFP failed to do so.

• Primary Identifier: Expr4659
• Subcellular Localization: The signal was detected on the surface of the gonad and within the gonad. In addition, somewhat weaker signals were detected at the surfaces of the intestine and hypodermis, as well as in the intestinal lumen).

• Primary Identifier: Expr4555
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4550
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4551
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4552
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4553
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4554
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4549
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr4542
• Pattern: Expressed in Many head neurons, ventral cord and tail neurons, body-wall muscle, hypodermis, somatic gonad, intestine.

• Primary Identifier: Expr4501
• Pattern: egl-43::YFP expression in the gonad was first detected in the pre-AC/pre-VU cells at early L2, and was maintained in their 37 descendants at early L4. egl-43::YFP was also expressed in the AC and VU cells when their cell fates become specified at mid-L2. Expression in the two dorsal uterine precursor (DU) cells (Z1.pap and Z4.apa) was first detected at late L2 and was maintained in their descendants. Thus, egl-43 is expressed in the AC, VU and DU lineages in the somatic gonad.

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5476
• Remark: Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC14155
• Reporter Gene: [rab-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAAGCCAAAGCCAAAGCC] 3' and primer B 5' [TGCTGCCATCTCCTTTTTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; distal tip cell; developing gonad; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5305
• Remark: Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. Strain: BC10484
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5085
• Remark: Strain: BC14118
• Reporter Gene: [B0546.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAAAGCACCGAAGACGTA] 3' and primer B 5' [CTTGAAACGCTGAGGATTCTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr16193
• Pattern: In the case of developmentally arrested dauer larvae, the enzyme was found in the nerve ring and along the body wall with the apparent lack of fluorescence signal in the gut. The latter location (along the body wall) reflects presumably the enzyme protein present in the gonad primordium.

• Primary Identifier: Expr16194
• Pattern: High enzyme level was also found in the nerve ring and gonad primordia of L3 and L4 larvae.

• Primary Identifier: Expr16195
• Pattern: Additionally, in L3 larvae, high level of the enzyme mRNA was also demonstrated by in situ hybridization in gonad primordium.

• Primary Identifier: Expr11592
• Pattern: UBXN-1, UBXN-2 and UBXN-3 were relatively strongly expressed in proximal gonads where MSP is localized, although UBXN-1, UBXN-2 and UBXN- 3 were ubiquitously localized in the gonads. More precisely, UBXN-1, UBXN-2 and UBXN-3 primarily localized at the periphery of spermatocyte nuclei, but not in mature sperm.

• Primary Identifier: Expr14274
• Pattern: Transcripts of R155.3, paa-1, W01B6.6 and upp-1 can be detected by RT-PCR in micro-dissected gonadal tissues, suggesting they are expressed in the germline.

• Primary Identifier: Expr8778
• Remark: Picture: Fig. 2C, 2D.
• Pattern: Transgenic worms expressing UPP-1::green fluorescent protein (GFP) showed bright GFP signal in the hypodermis, pharynx, and spermatheca. UPP-1::GFP was also expressed in the gonad.

• Primary Identifier: Expr10747
• Pattern: TCER-1::GFP was present in all germ cell nuclei, starting from the mitotic cells at the distal end to the oocytes at the proximal end of the gonad. TCER-1::mCherry showed an identical expression pattern (data not shown). Both of these transgenes were expressed in somatic nuclei as well (data not shown). TCER-1 reporter fusions were present at the inner periphery of the nucleus, often in a crescent-shaped fashion. However, we did not detect any fluorescence signal corresponding to either of the TCER-1 reporter fusions in the cytoplasm.
• Subcellular Localization: TCER-1 reporter fusions were present at the inner periphery of the nucleus.

• Primary Identifier: Expr2372
• Pattern: hip-1::CFP expression was restricted to the germline, gonad, pharynx, and several neurons that extend axons along the dorsal and ventral nerve cords.

4 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The second stage larva. At 25 Centigrade, it ranges 25.5-32.5 hours after fertilization, 11.5-18.5 hours after hatch.		L2 larva Ce	WBls:0000027
	The fourth stage larva. At 25 Centigrade, it ranges 40-49.5 hours after fertilization, 26-35.5 hours after hatch.		L4 larva Ce	WBls:0000038
	The first stage larva. At 25 Centigrade, it ranges 14-25.5 hours after fertilization, 0-11.5 hours after hatch.		L1 larva Ce	WBls:0000024
	The third stage larva. At 25 Centigrade, it ranges 32.5-40 hours after fertilization, 18.5-26 hours after hatch.		L3 larva Ce	WBls:0000035

3 Parents

Definition	Name	Synonym	Primary Identifier
	reproductive system		WBbt:0005747
	reproductive tract		WBbt:0005744
a collection of cells or cell groups that collectively perform a function	organ		WBbt:0003760