WormMine: AnatomyTerm WBbt:0005739

• Definition: anterior-most body region containing the pharynx.
• Name: head
• Primary Identifier: WBbt:0005739

4 Children

Definition	Name	Synonym	Primary Identifier
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
body wall muscle in the head, including first eight cells of each muscle quadrants which are innervated by nerve ring neurons.	head muscle	head body wall muscle	WBbt:0006761
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
ganglion in the head.	head ganglion		WBbt:0005135

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in anterior head region, according to RNA tomography.	RNA tomography	WBPaper00055648:anterior-head_expressed

661 Expression Patterns

• Primary Identifier: Expr16505
• Pattern: We examined the expression of pals-17p::GFP and pals-20p:: wrmScarlet transcriptional reporters at the L4 stage. Both transgenes were expressed in intestinal tissue, especially in the anterior-most and posterior-most intestinal cells. Furthermore, we found that both reporters were expressed in the head region. pals-17p::GFP signal was present in head neurons, whereas pals-20p::wrmScarlet was sporadically and weakly expressed in the head region.

• Primary Identifier: Expr4984
• Pattern: By in situ hybridization, the remaining gene, F44A2.3, is reported to show weak but specific expression at the vulva and in the head.

• Primary Identifier: Expr4502
• Pattern: A transcriptional reporter for sel-2 in which the 5' upstream region drives nuclearly localized YFP is expressed in the VPCs and their descendants, as well as in many other cell types, including the epithelial cells of the intestine and the rectum, the seam cells, many cells in the head and the tail, and the cells of the ventral nerve cord.

• Primary Identifier: Expr5295
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC10160
• Reporter Gene: [vha-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATCCGCCTGAAAAATCA] 3' and primer B 5' [GATTCCGATGGCTACAGTCG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in head; Larval Expression: hypodermis; excretory cell

• Primary Identifier: Expr5297
• Remark: Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5299
• Remark: Strain: BC12707
• Reporter Gene: [C18A3.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTCGTTCATAATGCTGCG] 3' and primer B 5' [TGAAGAAGGAGATGGCTTAAATG] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5290
• Remark: Also expressed in (comments from author) : Unidentlified cells in head Strain: BC12669
• Reporter Gene: [C17G10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCGACTCGAGGAACTGT] 3' and primer B 5' [CTGGGGAAGATCGATTGGT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Larval Expression: pharynx; pharyngeal gland cells; intestine; body wall muscle; unidentified cells in head

• Primary Identifier: Expr5291
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173
• Reporter Gene: [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5282
• Remark: Strain: BC12920
• Reporter Gene: [rol-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAAACTCGTTCCATCATT] 3' and primer B 5' [GTCGTCATGTACAGGCTGTCT] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Embryo Expression: body wall muscle; hypodermis; Larval Expression: body wall muscle; hypodermis

• Primary Identifier: Expr5263
• Remark: Also expressed in (comments from author) : low intensity GFP in unidentified cells. Strain: BC12234
• Reporter Gene: [ceh-16::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATACCACAAGTTTTTGGCCG] 3' and primer B 5' [CTAAGGAAGCTCCGCCTCTT] 3'.
• Pattern: Adult Expression: seam cells; Nervous System; head neurons; unidentified cells in head; Larval Expression: seam cells; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr5264
• Remark: Also expressed in (comments from author) : 2 unidentified cells in larval head Strain: BC14409
• Reporter Gene: [C14A4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCATTTCCGTTACCATTTTACTTC] 3' and primer B 5' [CGACGATCTTTCCCGTTG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; unidentified cells in head

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5267
• Remark: Strain: BC12527
• Reporter Gene: [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; head neurons; unidentified cells in head; Larval Expression: pharynx; intestine; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr5268
• Remark: Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. Strain: BC10468
• Reporter Gene: [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'.
• Pattern: Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head

• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head

• Primary Identifier: Expr5260
• Remark: Strain: BC13890
• Reporter Gene: [C13G3.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAATACCCTAAAAATCCCAACA] 3' and primer B 5' [GAAATGATAAATATGAGGGCCG] 3'.
• Pattern: Adult Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5242
• Remark: Also expressed in (comments from author) : unidentified cells in head, possibly neural Strain: BC13447
• Reporter Gene: [C11E4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCGAAGAAGGCAACA] 3' and primer B 5' [CAAAGTGCGATTTTCGTATCTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; unidentified cells in head; Larval Expression: pharynx; intestine; rectal gland cells; hypodermis; unidentified cells in head

• Primary Identifier: Expr5237
• Remark: Strain: BC11515
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; unidentified cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; unidentified cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5238
• Remark: Strain: BC10781
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; gonad sheath cells; Nervous System; tail neurons; Larval Expression: pharynx; seam cells; unidentified cells in head

• Primary Identifier: Expr5231
• Remark: Strain: BC11858
• Reporter Gene: [C10C6.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGATGATGATTGCCAAATAAAA] 3' and primer B 5' [TGTCGCGATCTGAAAAAGAATA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head

• Primary Identifier: Expr5233
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products.Unidentified cells in head, possibly neural. Strain: BC11180
• Reporter Gene: [ceh-33::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCTCAAGTCGCCTAATCC] 3' and primer B 5' [CGGTTGGATATTGCTCGGGTTG] 3'.
• Pattern: Adult Expression: unidentified cells in head; Larval Expression: unidentified cells in head

• Primary Identifier: Expr5236
• Remark: Strain: BC12473
• Reporter Gene: [C10H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGAATGAACGGAGGGAC] 3' and primer B 5' [GCGATGATCAAATGATCTGAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5221
• Remark: Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. Strain: BC12217
• Reporter Gene: [C09F5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCAGCGTTTTCAACTGAT] 3' and primer B 5' [CGTGTGAACGAGGGATCTG] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; spermatheca; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5223
• Remark: Strain: BC13281
• Reporter Gene: [C09G12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTTTTCACCAAGTTTGC] 3' and primer B 5' [TGGGCCGAGATGAGGTAG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5218
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16286
• Reporter Gene: [C09E7.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGAACTTCTCCTGTGCTCCC] 3' and primer B 5' [AGTCGTCGTCGATTTTTATCTGA] 3'.
• Pattern: Larval Expression: pharynx; intestine; rectal gland cells; unidentified cells in head

• Primary Identifier: Expr5200
• Remark: Strain: BC10784
• Reporter Gene: [clh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGTAGTTCGCCCGTTAAT] 3' and primer B 5' [TCGGCTGGAATAAAAGAACAAT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5203
• Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. Strain: BC12754
• Reporter Gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5196
• Remark: Strain: BC13845
• Reporter Gene: [tlk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCACACAGACAACAGTTCC] 3' and primer B 5' [CGTACGGACGGTGCAGATA] 3'.
• Pattern: Adult Expression: pharynx; intestine; hypodermis; Larval Expression: pharynx; intestine; hypodermis; unidentified cells in head

• Primary Identifier: Expr5195
• Remark: Strain: BC14465
• Reporter Gene: [C06H2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCAAAGAAAAGGATAGTTCCA] 3' and primer B 5' [CGCCAGCTGATCTGGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5185
• Remark: Also expressed in (comments from author) : This strain is an UNC. Strain: BC12544
• Reporter Gene: [stdh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTGACCCTATTCAACAAAA] 3' and primer B 5' [TGTCGAAGATTTTAGCAAAATTAG] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738