WormMine: AnatomyTerm WBbt:0005656

• Definition: Ganglion that lies at the anterior limit of the ventral nerve cord, near the ventral ganglion and nerve ring in the head posterior to the excretory pore. It is open and continuous with the region containing the motoneurons of the ventral cord. In the early L1 this ganglion holds 12 neuron cell bodies plus one neuroblast (Sulston and Horvitz, 1977; White et al., 1986). In the adult animal, the ganglion holds 20 neuron cell bodies.
• Name: retrovesicular ganglion
• Primary Identifier: WBbt:0005656

1 Children

Definition	Name	Synonym	Primary Identifier
neuron whose cell body is in the retrovesicular ganglion.	retrovesicular ganglion neuron	retrovesicular ganglion	WBbt:0005403

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Expressed transcripts enriched in embryonic motor neurons (identified by unc-4::GFP expressing cells).	Comparisons of RMA normalized intensities for unc-4::GFP vs reference cells were statistically analyzed using Significance Analysis of Microarrays software (SAM, Stanford). A two-class unpaired analysis of the data was performed to identify genes that differ by 1.7-fold from the wildtype reference at a False Discovery Rate (FDR) of 1%. These genes were considered significantly enriched.	WBPaper00025141:unc-4::GFP_Enriched_Genes
	Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells).	Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations.	WBPaper00025141:unc-4::GFP_Expressed_Genes

36 Expression Patterns

• Primary Identifier: Expr4985
• Remark: Picture: Fig 5.
• Pattern: GFP expression was specifically localized to a few cells at the anterior and posterior regions of the worm. At the anterior region, the GFP expression was identified in two amphid neurons (ASG), the pharyngeal intestinal (PI) valve (six cells), one to two neurons in retrovesicular ganglion (RVG), and two neurons posterior to the PI valve. The GFP expression in the posterior region was localized to the two phasmid neurons (PHA, PHB) and the anal valve (four cells). The results indicated that the promoter of CEFT-1 is specifically activated in chemosensory neurons (amphids and phasmid neurons) and valve regions (PI valve and anal valve). Promoter expression was evident through all developmental stages with a highly restricted GFP expression.

• Primary Identifier: Expr11753
• Remark: genomic

• Primary Identifier: Expr12829
• Reporter Gene: fosmid fUL#SB98
• Pattern: Fluorescence of the mCherry driven from the recombineered sir-2.1 fusion gene was observed in nerve cells of the head, the ventral nerve cord and the tail, and in the hypodermis, as described previously for a conventional reporter gene fusion (Wang and Tissenbaum, 2006). On top of this, however, mCherry fluorescence was also observed in muscle and intestinal cells, and potentially other additional cell types.
• Subcellular Localization: In all cell types the mCherry fluorescence was throughout the cytoplasm, but also nuclear-enriched.

• Primary Identifier: Expr12719
• Pattern: acc-1 and acc-2 fosmid reporters show very restricted and non-overlapping expression in the adult nervous system. The acc-1 fosmid reporter is expressed in a subset of cholinergic neurons, including cholinergic neurons in the ventral nerve cord, the retrovesicular ganglion and a few head neurons (including the SMD, RMD motor neurons, the AVA and AVE command interneurons and the SAA neurons). A small number of glutamatergic neurons also express acc-1 (including the pharyngeal neurons MI and M3, the PLM neurons and an unidentified neuronal pair in the lateral ganglion).

• Primary Identifier: Expr720
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Prominent staining of the entire nervous system, specially the axonal processes emanating from neuronal cell bodies is observed at all developmental stages. Neuronal processes including axonal and dendrites consistently stains brighter than the cell bodies. Staining is detected in the central neurophil (nerve ring) in the head, the ventral cord consisting of motor neurons along the body length, lateral nerve cords, lumbar commissures and neuronal cell bodies in the tail ganglia. Staining is observed in the six sets of touch receptor neurons ALML, ALMR, PLML, PLMR, AVM and PVM. In the head region, neurons and their axonal and dendritic processes in the anterior ganglia, lateral ganglia, ventral ganglion, retro-vesicular ganglion and the nerve ring consisting of axonal fibres from neurons located in the head and tail ganglia are brightly labeled. Neurons and their axonal processes are stained in the tail, which has a pair of bilaterally symmetric lumbar ganglia, a small dorso-rectal ganglion and the pre-anal ganglion at the posterior end of the ventral cord. Besides the major axonal bundle of the ventral nerve cord, the dorsal nerve cord and a set of lateral cords along the body length are also stained. Muscle cells, intestine and hypodermal cells stain weakly. Staining of the mitotic spindles in C. elegans are clearly visible in embryos and meiotic spindles in the germline cells in the gonad of adult hermaphrodites. Spindles are stained more strongly and non-spindle structures.
• Subcellular Localization: Stained in neuronal processes and cell bodies. Spindles are stained more strongly.

• Primary Identifier: Expr3209
• Pattern: Expression of the UNC-116::GFP and KLC-2::GFP fusion proteins was seen broadly in multiple tissues including most of the neurons, muscles, and pharynx.
• Subcellular Localization: The GFP expression within a given cell was in general diffuse and excluded from the nucleus.

• Primary Identifier: Expr122
• Remark: Other strain-- UL403 late embryo(author) = elongating embryo + fully-elongated embryo(curator).
• Pattern: Expression begins in precomma stage embryos. It is quite strong, with extensive diffuse cytoplasmic staining as well as nuclear localised staining. Expression is strongest in young larvae, with staining observed in the ventral nerve cord, the circumpharyngeal nerve ring, the head ganglion, the tail ganglion, the retrovesicular ganglion, and in the developing vulva. In older larvae and in adults the strong pharyngeal expression seen in young larvae is less intense and some neuronal processes in the head become apparent (e.g. the motorneuron M1). There is also staining in the pharyngo-intestinal valve and in the seam cells, though expression appears to exclude the nuclei and is generally intermittent along the seam. The defecation muscle group stain as does its axon, DVB. The dorsal cord also stains but is very faint. Two commissures stain (these are also faint), one is located anterior to the vulva, and the other is posterior to the vulva.

• Primary Identifier: Expr948
• Remark: GFP expression matched the expression pattern of a daf-4::gfp gene fusion (Patterson et al., 1997), suggesting that daf-4 regulatory sequences conferring tissue-specificity are upstream of the transcription start site.
• Pattern: GFP was expressed in the pharynx, intestine, hypodermis and body wall muscles, in L1 through adult stages. In the head, GFP was seen in neurons of the lateral, vesicular and retrovesicular ganglia. Ventral cord neurons also were visible, as was the PVT neuron, but only two phasmid neurons were detected in the tail. Whereas the nervous system is the primary site of gfp expression mediated by the daf-1 promoter, the daf-4 promoter directs expression more broadly, consistent with its other functions. In L1 larvae, when the dauer/nondauer decision is made, daf-4 promoter is active in neurons in the head, as well as in the ventral cord and tail. The promoters continues to express GFP in dauer larvae from starved plates.

• Primary Identifier: Expr14080
• Remark: Other Strain: OH14302
• Pattern: pharynx, pharyngeal-intestinal valve, head mesodermal cell, vulva, ASH, few head and RVG neurons (not distinct expression), PVT sometimes, phasmids (variable), male rays

• Primary Identifier: Expr14128
• Pattern: neurons in RVG, strong pharyngeal expression, sometimes excretory cell

• Primary Identifier: Expr10030
• Pattern: rsbp-1 transgene was expressed in head and tail neurons and motor neurons of the ventral cord that innervate body-wall muscle cells. Expression was also observed in vulval, pharyngeal, and body-wall muscle cells. The rsbp-1p::GFP transgene was expressed in many ventral cord motor neurons. We consistently found rsbp-1p::GFP expression in ventral cord neurons between the retrovesicular ganglia and pre-anal ganglia indicating that RSBP-1 was expressed in both cholinergic and GABAergic motor neurons.

• Primary Identifier: Expr7838
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion. Taken together, these results indicate that unc-69 is expressed widely, perhaps ubiquitously, in the C. elegans nervous system.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites.

• Primary Identifier: Expr7837
• Remark: Picture: Figure 5 and Table 1.
• Pattern: These Psnf-11::GFP fusions are expressed in the same neurons (RMEs, AVL, DVB, RIS, and RID) that stained with the anti-SNF-11 polyclonal antibodies. Expression was also noted in two additional neurons near the pharynx as well as two neurons in the retrovesicular ganglion. There were no apparent differences in expression between the two reporters, suggesting that the 1.9-kb region is sufficient to drive expression in all snf-11 positive cells. In contrast to observations reported previously (Jiang et al., 2005 blue right-pointing triangle), authors did not observe snf-11 expression in the ventral cord inhibitory (DD and VD) motor neurons. However, they did observe robust expression in the body wall, anal, and uterine muscles that was not noted previously. In young animals, expression of the Psnf-11::GFP reporter in muscle cells is the most prominent aspect of the expression pattern.

• Primary Identifier: Expr50
• Remark: Fusion junction ...AGCTCTCCAACGATGTACGAGAGAAGGATGCTGGGAAGGTCGTGGAAGTGTTGAAAGTCACGACCACGG TCAATAGATTATGTAGAGGATTCCCTACGTCACGAGTATCTAGATGGATTGCAAGGGGAAGAGGACGCACTG GCAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Krupa AP" "Hope IA". Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]
• Pattern: b-galactosidase expression in areas of all the major ganglia (lateral, ventral, retrovesicular, pre-anal and dorso-rectal), along the ventral nerve cord, occasionally in the spermathecal valves and in the vulva. Expression appears to be nuclear-localized, although cell bodies and neural processes in the ventral nerve cord also show staining. The pattern is first visualized as a stripe of staining following the curve of the elongating embryo, possibly corresponding to the embryonic ventral nerve cord which consists of the DA, DB and DD motorneurones

• Primary Identifier: Expr45
• Pattern: Post-embryonic expression. Neurons. Higher levels in cells that express mec-7. In larvae, cell bodies in RVG, ventral cord and posterior lateral ganglia. Other cells seen less frequently, including cells in lateral hypodermis. Germ cells in adult hermaphrodites.

• Primary Identifier: Expr94
• Remark: Legacy Data: "Bauer PK" "Mounsey A" "Royall CM" "Hope IA" Date 1997-07.
• Pattern: Expression of this neural pattern is first seen prior to the embryonic comma stage, and extends through to adulthood. Strong staining is seen in the ventral nerve cord and its cell bodies, in the retrovesicular ganglion, the circumpharyngeal nerve ring, and in the rectal muscle group involved in defecation (anal depressor, sphincter muscle and intestinal muscle). The DVB neuron which innervates this muscle group also exhibits staining. Weaker staining can be observed in the dorsal nerve cord and in some commissures possibly of VD or DD type. Staining appears to be in foci along the commissures.

• Primary Identifier: Expr112
• Remark: Other strain-- UL481. Legacy Data: "Bauer PK" "Mounsey A" "McCarroll D" "Hope IA"Date 1998-12. late embryo(author) = 3-fold embryo(curator).
• Pattern: This neuronal pattern gives expression throughout all life stages of C. elegans. Staining is first seen in precomma stage embryos. In 3-fold embryos expression appears to be localised in nuclei around the pharynx and tail. In young larvae there is extensive staining in all of the head ganglia and the anal ganglion. The ventral nerve cord and its cell bodies also show strong expression. As the worm ages the expression in the head ganglia is reduced to a number of nuclei in the ventral (ie AIML/R?) and lateral ganglion, although expression in the nerve ring and the ventral nerve cord is still observed. There appears to be some mosaicism in the expression as some larvae show stronger staining in the ventral nerve cord and more nuclei stain in the head ganglia, whereas in other larvae head expression is reduced and only the cell bodies of the ventral nerve cord stain. Diffuse expression is sometimes observed in the metacorpus and terminal bulb of the pharynx in larvae and adults.

• Primary Identifier: Expr11322
• Pattern: Adult: strong expression in vulval epithelium, gut, head muscle, pharynx: pm1,6,7,8, I3(?), a few more pharyngeal cells (neurons? epithelium); some arcade cells, excretory duct cell, 4 neurons in the retrovesicular ganglion, rectal glands, one additional rectal cell; occasionally hyp (expresses strongly in young larvae)

• Primary Identifier: Expr1872
• Pattern: In late L2 larvae anti-PAG-3 staining was seen in approximately two dozen cells in the head, all six mechanosensory neurons, the BDU neurons, approximately ten cells in the tail as well as in the ventral cord. PAG-3 staining of many cells in the head and tail remained detectable in adult animals. In the ventral cord, PAG-3 was first detected in the Pn.aa neuroblasts. PAG-3 was not detected in the Pn.ap euroblasts or their descendants. PAG-3 was present equally in each of the descendant cells of Pn.aa after subsequent rounds of division (i.e. the Pn.aaa, Pn.aap, Pn.aaaa and Pn.aaap cells), including the three differentiating neurons generated by each Pn.aa neuroblast. In most cells, PAG-3 protein became undetectable shortly after the cells had been generated in the L1, but PAG-3 was present in six cells in the ventral cords of adults. In late L2 larvae anti-PAG-3 staining was seen in approximately two dozen cells in the head, all six mechanosensory neurons, the BDU neurons, approximately ten cells in the tail as well as in the ventral cord. PAG-3 staining of many cells in the head and tail remained detectable in adult animals. In the ventral cord, PAG-3 was first detected in the Pn.aa neuroblasts. PAG-3 was not detected in the Pn.ap neuroblasts or their descendants. PAG-3 was present equally in each of the descendant cells of Pn.aa after subsequent rounds of division (i.e. the Pn.aaa, Pn.aap, Pn.aaaa and Pn.aaap cells), including the three differentiating neurons generated by each Pn.aa neuroblast. In most cells, PAG-3 protein became undetectable shortly after the cells had been generated in the L1, but PAG-3 was present in six cells in the ventral cords of adults. PAG-3 expression persisted throughout the life of the animal in four cells in the retrovesicular ganglion at the anterior end of the ventral cord and in two cells in the posterior ventral cord. In newly hatched L1-stage larvae, before the initiation of the postembryonic W and P cell lineages, two cells in the retrovesicular ganglion expressed PAG-3. Based on position, these cells were most likely the RIG interneurons. After completion of the W and P cell lineages, two additional cells in the retrovesicular ganglion and two cells in the posterior ventral cord contained detectable PAG-3 protein. These nuclei might be the two AVF and the VA11 and VA12 neurons, respectively. This hypothesis was confirmed by staining animals carrying an integrated Punc-4lacZ reporter, which is expressed in the AVF and VA as well as other neurons, with PAG-3 antiserum and monoclonal antibody against beta-galactosidase. PAG-3 protein was expressed more widely in the nervous system than had been observed using the Ppag-3lacZ reporter. PAG-3 was detected during embryonic development in many nuclei ~280 minutes after fertilization.

• Primary Identifier: Expr12869
• Pattern: qui-1::GFP was visible in the processes of the nerve ring and in several neurons of the lateral and ventral ganglia, including the avoidance sensory neurons ASH and ADL. GFP expression was not detected in ASK sensory neurons. Four additional neurons in the retrovesicular ganglion and two neurons in the lumbar ganglion, PVQ and the sensory neuron PHB, also express GFP. This expression pattern partially overlaps but is not completely coincident with that obtained with a much shorter construct in which GFP was fused to the second exon, and the construct was thus missing part of exon 2 and the last 17 introns and exons of the gene (not shown). Expression from this shorter construct included neither ASH nor PHB, indicating that important regulatory elements are present within the coding region of qui-1.
• Subcellular Localization: In the ASH sensory neurons, the reporter protein uniformly stained the cell body, nucleus, dendrite and axon. The staining was too faint to unambiguously determine whether QUI-1::GFP localized also in the cilia. In most of the other neurons, expression of GFP was lower in all cellular compartments and apparently absent from the nucleus.

• Primary Identifier: Expr14215
• Remark: Other Strains: OH14379
• Pattern: ASI, ASH, 1 neuron pair around the RVG (seems a bit more dorsal though - projects ventrally), PHA, PHB, PVQ

• Primary Identifier: Expr3991
• Pattern: Expression started at the end of gastrulation. At the 2-fold stage, about 60 cells in the head express ast-1, most of them neurons, but also a few cells in the pharynx. A single cell in the retrovesicular ganglion expresses AST-1::YFP throughout development from the 1.5-fold stage onward. Using an odr-2::CFP marker and checking for overlap in expression, this cell was identified as the AVG neuron. The ALN neurons in the tail weakly express AST-1::YFP in late embryo and early larval stages. Occasionally, a second pair of cells in the tail was seen based on cell body position most likely the rectV cells. Expression in the tail generally is weak and somewhat variable from animal to animal. In the L1 stage, AST-1::YFP coexpressed with glr-1::CFP in AVA, AVD (weak ast-1), AVE (weak ast-1) RMDD and SMDD as well as AVG. AST-1::YFP expression decreases during larval development and is restricted to few neurons, which continue to express throughout the entire life cycle.
• Subcellular Localization: The YFP signal was initially seen only in the nucleus consistent with AST-1 being a transcription factor. Already beginning in the 3-fold stage, a redistribution of the YFP signal was seen until most of the signal is outside the nucleus mainly in spots in the cell body but also in the neuronal processes.

• Primary Identifier: Expr14170
• Remark: Other Strain: OH14759
• Pattern: ASK, AWA, one neuron in RVG

• Primary Identifier: Expr14122
• Pattern: ASJ, ASI, 3 inter/motorneurons from RVG, gut

• Primary Identifier: Expr14151
• Pattern: ADF, ASI (dim), URX, sometimes 1 inter/motorneurons in the ventral ganglion or RVG

• Primary Identifier: Expr3279
• Pattern: In the embryo, the downstream promoter (ten-1b) is most active in the descendants of the ABp cell and in the hypodermis. The dorsal hypodermal cells and the ventral leader cells were most prominently labeled. During postembryonic development, GFP fluorescence was visible in specialized epithelial cells including the arcade cells of the anterior end and the excretory duct. Ten-1b is also active in a subset of neurons including CAN and HSN neurons as well as neurons of the lumbar and retro-vesicular ganglion and some nerve ring interneurons. In males, GFP fluorescence is also visible in R8 and R9 ray neurons.

• Primary Identifier: Expr3158
• Pattern: The mau-2 transcript is abundant in the embryonic and young adulthood stages, whereas it is present in low amounts throughout the larval stages.

• Primary Identifier: Expr15183
• Pattern: We examined cnd-1p::mCherry expression in early L1 larvae, within an hour of hatching, counting nuclei in the retrovesicular ganglion and also the ventral nerve cord. The retrovesicular ganglion is a linear cluster of cells located on the ventral midline of the worm immediately posterior to the pharynx, and contains the anterior most DA, DB and DD motorneurons (DA1, DB1, DB2 and DD1), along with eight additional cells. Wild type animals showed an average of nine cnd-1p::mCherry nuclei in the retrovesicular ganglion and 10 in theventral nerve cord (n = 26). As there are 22 motorneurons in early L1 larvae, this suggests that only a subset express the cnd-1 reporter gene. Based on their location along the ventral nerve cord, co-labeling with unc-25p::GFP (a known DD neuron marker), and by corroborating against single cell RNA-seq expression data (Packer et al. 2019), we tentatively conclude that cnd-1p::mCherry is expressed in DA1-5, DB1, DB3, and DD1-6.

• Primary Identifier: Expr15184
• Pattern: In wild type, cnd-1p::mCherry and ceh-13p::GFP showed a complex and partially overlapping expression pattern in the retrovesicular ganglion and ventral nerve cord, with around two cells co-expressing cnd-1 and ceh-13 in the ganglion and an average of 4.1 cells co-expressing in the ventral nerve cord.

• Primary Identifier: Expr725
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). let-70 = ubc-2 --WS59.
• Reporter Gene: [ubc-2::lacZ] translational fusion. To make constructs pZMI.1 and pZMII.1, the lacZ coding region, a 3.3 kb BamHI-ApaI fragment from pPD16.43, was inserted in-frame into the second exon (BamHI-ApaI sites) of the ubc-2 genomic clone. PZMII.1 contained the 1.4 kb HindIII-BglII upstream sequence and the 2.6 kb 3' non-coding sequence. In pZMI1, a 6 kb BglII fragment preceding the initiation methionine codon and 2.6 kb of sequences downstream of the TAG stop codon was included in the construct to provide regulatory elements for expression.
• Pattern: UBC-beta-gal expression (from pZMI.1 and pZMII.1) was observed consistently in embryos, larvae and adults. Expression was detected in most cells in the embryos. In L1, L2, L3 and dauer larvae, most somatic tissues including neurons, pharynx, hypodermis and body muscle were intensely stained. In a small percentage of animals, intestinal staining were also stained. At the onset of L4, staining was restricted to neurons, pharynx and hypodermis. Staining was only seen in the nervous system in adults. An interesting feature of the expression patterns from pZMI.1 and II.1 is that, despite different tissue specificity in larval and adult stages, ubc-2-lacZ expression is seen constitutively in the nervous system at all post-embryonic stages. From L1 onwards, intense beta-gal staining was seen in ventral nerve cord, including P-cells and neurons, pharyngeal ganglia and retrovesicular ganglia.

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
ganglion in the trunk of the body.	body ganglion		WBbt:0005332