WormMine: AnatomyTerm WBbt:0006769

• Definition: nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA.
• Name: lateral nerve cord
• Primary Identifier: WBbt:0006769

0 Children

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Enriched in vulval muscle (adult), ventral nerve cord (larva), ventral nerve cord (adult), dorsal nerve cord (adult), body neurons (adult), body neurons (larva), tail neurons (larva), nerve ring (larva), dorsal nerve cord (larva), nerve ring (adult), body wall muscle (larva), lateral nerve cords/commissures (larva).		WBPaper00029359_1197
	Enriched in vulval muscle (adult), ventral nerve cord (larva), ventral nerve cord (adult), dorsal nerve cord (adult), body neurons (adult), body neurons (larva), tail neurons (larva), nerve ring (larva), nerve ring (adult), dorsal nerve cord (larva), body wall muscle (larva), lateral nerve cords/commissures (larva), tail neurons (adult).		WBPaper00029359_1546

97 Expression Patterns

• Primary Identifier: Expr4900
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in the cell bodies of neurons.

• Primary Identifier: Expr5193
• Remark: Strain: BC14658
• Reporter Gene: [clp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGTGTCTATTTGTTTGTTGCC] 3' and primer B 5' [GTCGGCTTTTGCTGTGAAA] 3'.
• Pattern: Adult Expression: pharynx; vulval muscle; Nervous System; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; Nervous System; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5185
• Remark: Also expressed in (comments from author) : This strain is an UNC. Strain: BC12544
• Reporter Gene: [stdh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTGACCCTATTCAACAAAA] 3' and primer B 5' [TGTCGAAGATTTTAGCAAAATTAG] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15051
• Reporter Gene: [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5145
• Remark: Strain: BC13645
• Reporter Gene: [C04F12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCGGTTGCCTCTAATAGT] 3' and primer B 5' [GGTGTAGAAACCGGATCTGAAA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons

• Primary Identifier: Expr5110
• Remark: Also expressed in (comments from author) : high intensity GFP, other tissues may be masked Strain: BC12752
• Reporter Gene: [C02E11.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAGGTCAAATTTTCGTCGATT] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5493
• Remark: Strain: BC10751
• Reporter Gene: [mec-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCAGACAGGAGCTGAA] 3' and primer B 5' [TTGCAAAAGAGGAGCTACAAGTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5476
• Remark: Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC14155
• Reporter Gene: [rab-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAAGCCAAAGCCAAAGCC] 3' and primer B 5' [TGCTGCCATCTCCTTTTTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; distal tip cell; developing gonad; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5521
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12012
• Reporter Gene: [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; unidentified cells in head; Larval Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; unidentified cells in head

• Primary Identifier: Expr5381
• Remark: Strain: BC14421
• Reporter Gene: [C29H12.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGGAAATTGTCGACTGCT] 3' and primer B 5' [GCCACGATCTTGTCTGAAACTAT] 3'.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; coelomocytes; Nervous System; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5304
• Remark: Also expressed in (comments from author) : early embryo is only gut. Strain: DM12525
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterus; vulva other; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head

• Primary Identifier: Expr5404
• Remark: Strain: BC11436
• Reporter Gene: [C33A11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGTCAAGCATTGAATCGGT] 3' and primer B 5' [TCGTACTTTCGGATCACGG] 3'.
• Pattern: Adult Expression: intestine - posterior cells; rectal epithelium; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine - posterior cells; rectal epithelium; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5055
• Remark: Also expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things. Strain: BC12796
• Reporter Gene: [arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; labial sensilla; neurons along body; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; head neurons; labial sensilla; tail neurons

• Primary Identifier: Expr5043
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15504
• Reporter Gene: [ntl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCTCGAACCCCATT] 3' and primer B 5' [GTCGTCTGCTAAGATCTGCAATAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr6867
• Remark: Strain: BC11520
• Reporter Gene: [Y102A11A.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAAGCGTCTGTAAATGTG] 3' and primer B 5' [TTGGCGATTATGCCTTTTTC] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; lateral nerve cords; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal gland cells; body wall muscle; Nervous System; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr8513
• Remark: Picture: Figure 4.
• Pattern: Expressed in head and tail neurons, nerve cord.

• Primary Identifier: Expr7738
• Remark: Clone: pUL#IAH10E8
• Pattern: Strong expression observed in UL2824. The same pattern but weaker was observed in UL2822. But no expression was observed in the only other line generated. Expression was mainly in 4 amphids and 4 other head nerve cells. Weaker expression also seen in dorsal and ventral nerve cords and tail nerve cells. Expression in lateral nerve cells and coelomocytes can be seen but even more weakly. There is also weak, potentially background, expression in posterior intestine and anterior body wall muscle cells. All of these components were seen from late embryogenesis to adult. In L1s, there is also weak expression in the hypodermis apart from the seam cells.

• Primary Identifier: Expr5693
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12773
• Reporter Gene: [pes-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTTGGGAAATGAGCCTTC] 3' and primer B 5' [GCTGGTTCGGTTTCGATAGTT] 3'.
• Pattern: Adult Expression: hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5689
• Remark: Strain: BC14781
• Reporter Gene: [F08G12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGTTCTAAGTTTTATGCGGTT] 3' and primer B 5' [TTGCGGAGAAGATCTGAATAATTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body

• Primary Identifier: Expr5997
• Remark: Strain: BC10950
• Reporter Gene: [let-92::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATTGGTTGAGCAGTCAGA] 3' and primer B 5' [GGGGCAGCAGCGATACTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; vulva other; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr5985
• Remark: Also expressed in (comments from author) : Strain not available. Strain: BC13659
• Reporter Gene: [F37H8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTGTTGTGCACTTTTCCC] 3' and primer B 5' [ATGGTTGTGCTGATGTTAGGG] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine

• Primary Identifier: Expr5944
• Remark: Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. Strain: BC14222
• Reporter Gene: [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body

• Primary Identifier: Expr5824
• Remark: Strain: BC13596
• Reporter Gene: [F22D6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCACGTGTACACCACACC] 3' and primer B 5' [TCTCGATTGGTGGACCTGA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; Larval Expression: intestine; Reproductive System; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons

• Primary Identifier: Expr6518
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14938
• Reporter Gene: [R13.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAATTTTTGAGCAAATGGG] 3' and primer B 5' [TTGTGGTGGCCAGATTGAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr8512
• Remark: Picture: Figure 4.
• Pattern: Expressed in head and tail neurons, nerve cord.

• Primary Identifier: Expr6616
• Remark: Strain: BC14362
• Reporter Gene: [T05D4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAAGAACAACTGTCAACTATGGG] 3' and primer B 5' [GCGAGTAAGAAGCGATTTTAGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca uterine valve; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr6618
• Remark: Strain: BC14315
• Reporter Gene: [T05H10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCTACGACACTCCGTT] 3' and primer B 5' [CCCGTACGATCTGGGAAAT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; tail neurons

• Primary Identifier: Expr6605
• Remark: Strain: BC15266
• Reporter Gene: [T04D1.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCGCTGACACCAACTCTCA] 3' and primer B 5' [CCCGACAACGAGATTTTTCT] 3'.
• Pattern: Adult Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr6497
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14834
• Reporter Gene: [srab-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGACCTCAGTTTTTGAG] 3' and primer B 5' [TGTTTTGTCTGAAAATTCGGG] 3'.
• Pattern: Adult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr6465
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14325
• Reporter Gene: [R05G6.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCCCTTTCTTTCGCATAG] 3' and primer B 5' [TGGTGGGGCGATTTTCTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
entity of anatomical origin that is either entirely acellular or is a collection of cells and acellular parts.	Anatomy	anatomical structure	WBbt:0005766
Part of the nervous system that lies completely outside the pharynx.	somatic nervous system		WBbt:0005760