WormMine: AnatomyTerm WBbt:0005747

• Name: reproductive system
• Primary Identifier: WBbt:0005747

4 Children

Definition	Name	Synonym	Primary Identifier
cell line which early in development becomes differentiated from the remaining somatic cell line, and alone has the potential to undergo meiosis and form gametes.	germ line	germline	WBbt:0005784
organ producing either sperm or ova.	gonad		WBbt:0005175
	muscle of the reproductive system		WBbt:0005786
anatomical part of the body which is involved in sexual reproduction and constitutes the reproductive system.	sex organ	genitalia	WBbt:0008422

0 Expression Clusters

718 Expression Patterns

• Primary Identifier: Expr5295
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC10160
• Reporter Gene: [vha-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATCCGCCTGAAAAATCA] 3' and primer B 5' [GATTCCGATGGCTACAGTCG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in head; Larval Expression: hypodermis; excretory cell

• Primary Identifier: Expr5296
• Remark: Strain: BC10524
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5297
• Remark: Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5290
• Remark: Also expressed in (comments from author) : Unidentlified cells in head Strain: BC12669
• Reporter Gene: [C17G10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCGACTCGAGGAACTGT] 3' and primer B 5' [CTGGGGAAGATCGATTGGT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Larval Expression: pharynx; pharyngeal gland cells; intestine; body wall muscle; unidentified cells in head

• Primary Identifier: Expr5292
• Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998
• Reporter Gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5293
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14694
• Pattern: Adult Expression: Reproductive System; vulval muscle; spermatheca; body wall muscle; Larval Expression: body wall muscle

• Primary Identifier: Expr5287
• Remark: Strain: BC13462
• Reporter Gene: [nas-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATATTGTAGGAGGCAAGTCG] 3' and primer B 5' [TGCAAAATAGAACATCAAGAATCG] 3'.
• Pattern: Adult Expression: rectal epithelium; Reproductive System; vulva other; seam cells; Larval Expression: rectal epithelium; hypodermis; seam cells

• Primary Identifier: Expr5289
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10522
• Reporter Gene: [C17G10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCGACTCGAGGAACTGT] 3' and primer B 5' [CTGGGGAAGATCGATTGGT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons

• Primary Identifier: Expr5282
• Remark: Strain: BC12920
• Reporter Gene: [rol-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAAACTCGTTCCATCATT] 3' and primer B 5' [GTCGTCATGTACAGGCTGTCT] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Embryo Expression: body wall muscle; hypodermis; Larval Expression: body wall muscle; hypodermis

• Primary Identifier: Expr5276
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14096
• Reporter Gene: [C16C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; amphids; unidentified cells in tail

• Primary Identifier: Expr5277
• Remark: Strain: BC15643
• Reporter Gene: [tag-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; amphids; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; seam cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5279
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14128
• Reporter Gene: [C16C10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGCCATATTGGTAGCTGTGG] 3' and primer B 5' [GACCGTTGCTGATTTTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5261
• Remark: Strain: BC14496
• Reporter Gene: [C13G3.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGTTCCGCAGACGC] 3' and primer B 5' [TGCAGGAATGATATCTCCTAGAAA] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5259
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15499
• Reporter Gene: [C13F10.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGTCCATTCCCTTGATAACTTGT] 3' and primer B 5' [TCGCGATCTGTAATTGTAGTGAAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; spermatheca; hypodermis; seam cells; Nervous System; head neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; hypodermis; seam cells; Nervous System; head neurons

• Primary Identifier: Expr5252
• Remark: Strain: BC13896
• Reporter Gene: [C13C4.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCACTTCTCCTCTTATCGC] 3' and primer B 5' [GATTCTTCGACCCTAAAGTTTCAA] 3'.
• Pattern: Adult Expression: Reproductive System; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5253
• Remark: Strain: BC10460
• Reporter Gene: [C13C4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACAAAGTGTGGAAAAGGGA] 3' and primer B 5' [TTTGTTTCTCACGATCGTTCAC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; hypodermis; excretory cell

• Primary Identifier: Expr5254
• Remark: Strain: BC12278
• Reporter Gene: [C13C4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACAAAGTGTGGAAAAGGGA] 3' and primer B 5' [TTTGTTTCTCACGATCGTTCAC] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5256
• Remark: Strain: BC15141
• Reporter Gene: [srr-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCCGCATCATCTTTTTC] 3' and primer B 5' [GGACTTGGAGTAATGATTGTTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr5258
• Remark: Strain: BC10711
• Reporter Gene: [C13F10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCTGGAAAAGTTAACAAAA] 3' and primer B 5' [GATCCATGAAACTGTTGAGTCTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5248
• Remark: Also expressed in (comments from author) : High intensity GFP may mask tissues. Strain: BC10894
• Reporter Gene: [C13B9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTATGACAAAATTTCTACGCGA] 3' and primer B 5' [CGGCGATCAACACGATTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; ventral nerve cord; unidentified cells in body ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in body

• Primary Identifier: Expr5246
• Remark: Strain: BC11926
• Reporter Gene: [C12D8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGAATGTGTACGAACGATCTG] 3' and primer B 5' [TCCTTCGATTTGATTCACAAAGT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5247
• Remark: Strain: BC10429
• Reporter Gene: [C12D8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGAATGTGTACGAACGATCTG] 3' and primer B 5' [TCCTTCGATTTGATTCACAAAGT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5237
• Remark: Strain: BC11515
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; unidentified cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; unidentified cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5238
• Remark: Strain: BC10781
• Reporter Gene: [let-502::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCACCAGATGAGCAATTTTGT] 3' and primer B 5' [CTGCAGCTCGATTTTCGTC] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; gonad sheath cells; Nervous System; tail neurons; Larval Expression: pharynx; seam cells; unidentified cells in head

• Primary Identifier: Expr5239
• Remark: Strain: BC10220
• Reporter Gene: [C11D2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTTCACCGAATGAACAGAT] 3' and primer B 5' [CGTCAATAAGGATTTTCTGACCT] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; Larval Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5234
• Remark: Strain: BC14107
• Reporter Gene: [C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail

• Primary Identifier: Expr5235
• Remark: Strain: BC11776
• Reporter Gene: [C10H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGAATGAACGGAGGGAC] 3' and primer B 5' [GCGATGATCAAATGATCTGAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; spermatheca; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: intestine; body wall muscle; hypodermis; Nervous System; tail neurons; unidentified cells

• Primary Identifier: Expr5236
• Remark: Strain: BC12473
• Reporter Gene: [C10H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGAATGAACGGAGGGAC] 3' and primer B 5' [GCGATGATCAAATGATCTGAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
intergrated group of organs, performing one or more unified functions.	Organ system		WBbt:0005746