WormMine: AnatomyTerm WBbt:0005738

• Definition: region of the body by which tissues, cells or cell parts are classified
• Name: body region
• Primary Identifier: WBbt:0005738

10 Children

Definition	Name	Synonym	Primary Identifier
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739
a region around premature germline, consists of cells of pedigree Z1 and Z4, which develops to become the somatic gonad.	gonadal primordium		WBbt:0008366
A fluid-filled space enclosed on the outside by the basal laminae of the bodywall tissues, principally those of the bodywall muscles and the hypodermis. Within this space the digestive tract and reproductive tract lie separately, each enclosed by its own basal lamina. Intercellular signals, nutrients and waste products can travel between all tissues bordering this space.	pseudocoelom	body cavity	WBbt:0005745
exterior tube of two concentric tubes that make up the body, includes the epidermal cells and the attached neurons and muscles.	body wall		WBbt:0005742
inner tube of two concentric tubes that make up the body	digestive tract		WBbt:0005743
body region posterior to the head and anterior to the tail	midbody		WBbt:0005740
	reproductive tract		WBbt:0005744
body region surrounding the anus.	anal region		WBbt:0006919
The extreme anterior portion of the body.	nose		WBbt:0008426

0 Expression Clusters

85 Expression Patterns

• Primary Identifier: Expr5297
• Remark: Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721
• Reporter Gene: [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5251
• Remark: Also expressed in (comments from author) : unidentified cells around vulva. Strain: BC11358
• Reporter Gene: [C13B9.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCTTGAAACATGATTGCCC] 3' and primer B 5' [ATCCGCGATGATATGAGTCAG] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ; Larval Expression: body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body

• Primary Identifier: Expr5248
• Remark: Also expressed in (comments from author) : High intensity GFP may mask tissues. Strain: BC10894
• Reporter Gene: [C13B9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTATGACAAAATTTCTACGCGA] 3' and primer B 5' [CGGCGATCAACACGATTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; ventral nerve cord; unidentified cells in body ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in body

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5185
• Remark: Also expressed in (comments from author) : This strain is an UNC. Strain: BC12544
• Reporter Gene: [stdh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTGACCCTATTCAACAAAA] 3' and primer B 5' [TGTCGAAGATTTTAGCAAAATTAG] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5171
• Remark: Strain: BC10312
• Reporter Gene: [let-756::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCCATTCCTTCTCGGTTT] 3' and primer B 5' [CAGGAACGGCGATATATTCA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; head neurons; unidentified cells in body ; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons; unidentified cells in body

• Primary Identifier: Expr5143
• Remark: Also expressed in (comments from author) : Expression in 2 non-DiI stained head neuron pairs between anterior and posterior pharyngeal bulbs, sending dendrites to tip of nose (Hober Lab apr 2005). Strain: BC15142
• Reporter Gene: [srd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTCTTTTTCTATCGACGAGC] 3' and primer B 5' [TCTTGTGCGATTCTGACAAATTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; Nervous System; head neurons; tail neurons; phasmids; Larval Expression: intestine; Reproductive System; Nervous System; head neurons; tail neurons; phasmids; unidentified cells in body

• Primary Identifier: Expr5104
• Remark: Also expressed in (comments from author) : There are two cells expressing GFP in the body. Strain: BC12188
• Reporter Gene: [hlh-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGCTTTCAAAATCCCAAACA] 3' and primer B 5' [GCCACGATCTGTGAAAATCATA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; unidentified cells in body

• Primary Identifier: Expr5473
• Remark: Strain: BC15639
• Reporter Gene: [C38H2.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGGTTACCTTTCTTGTTCAGA] 3' and primer B 5' [AACCGTCTCTTGATTTCTCATTTC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; spermatheca; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5463
• Remark: Also expressed in (comments from author) : Unidentified cells in head and around vulva. Strain: BC11105
• Reporter Gene: [C37E2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCACCGAGTAAAATACGCAA] 3' and primer B 5' [AGGATGCTGAAAACATTGGAGT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulva other; gonad sheath cells; body wall muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: body wall muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5459
• Remark: Strain: BC11970
• Reporter Gene: [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body

• Primary Identifier: Expr5421
• Remark: Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. Strain: BC10161
• Reporter Gene: [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5412
• Remark: Also expressed in (comments from author) : unidentified cells in head and around vulva.High intensity GFP.Mosaic population. Strain: BC12993
• Reporter Gene: [C33H5.18a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATTCAAAATAGGCTATCGAAAA] 3' and primer B 5' [GGTTGATCGGAGATCTGAAAAAT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5527
• Remark: Strain: BC14848
• Reporter Gene: [prx-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTGGTTTCCCCGTTTTT] 3' and primer B 5' [TTTTGGAGAAGCTGAACGAGA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; head mesodermal cell; hypodermis; unidentified cells in body ; Larval Expression: intestine; rectal gland cells; head mesodermal cell; hypodermis

• Primary Identifier: Expr5393
• Remark: Also expressed in (comments from author) : unidentified GFP pattern in gonadal region in L4 animals Strain: BC12847
• Reporter Gene: [C30H6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGAAAATTGTATGTTGGGGAAA] 3' and primer B 5' [ACCTTCGGACATGATTTTATGTAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; vulva other; spermatheca; gonad sheath cells; hypodermis; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; hypodermis; unidentified cells in body

• Primary Identifier: Expr5385
• Remark: Also expressed in (comments from author) : Possibly seeing arcade cells. Strain: BC12665
• Reporter Gene: [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterine-seam cell; vulva other; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5371
• Remark: Strain: BC10163
• Reporter Gene: [dnc-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAGCGCGATGAGATCTATTT] 3' and primer B 5' [TGACGCAAGATTTGAGAGTTTC] 3'.
• Pattern: Adult Expression: pharynx; unidentified cells in body ;unidentified cells in tail ; Larval Expression: unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5334
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15046
• Reporter Gene: [rap-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATGAATGGAGCATATTCTTCTG] 3' and primer B 5' [TGAACTCCCTGATTGAGAGTTTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterus; vulval muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ; Larval Expression: pharynx; intestine; rectal gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr7133
• Remark: Also expressed in (comments from author) : unidentified reproductive tissue is before spermatheca. Strain: BC11735
• Reporter Gene: [Y82E9BR.14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGAATTTCGATAATTTTTCATTT] 3' and primer B 5' [TGATGATGACGTGATCTTGAAAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; Nervous System; head neurons; unidentified cells in body ; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons

• Primary Identifier: Expr7197
• Remark: Strain: BC10675
• Reporter Gene: [ZK177.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTATCACAGAATGTTCGGCACT] 3' and primer B 5' [GCTTTGCCAGTTGATATTGC] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr7156
• Remark: Strain: BC15568
• Reporter Gene: [ZC317.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCATTATCTGTTGAATACGCCAC] 3' and primer B 5' [TCGATCATGTCAGGAGAAAAATAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Larval Expression: intestine; rectal gland cells; Reproductive System; unidentified cells in body

• Primary Identifier: Expr5665
• Remark: Strain: BC14203
• Reporter Gene: [lin-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTTTGGCCTTAAACAATTCG] 3' and primer B 5' [ACTACCGTCGAGATCCTGAAAA] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; unidentified cells in body ; Larval Expression: pharynx; body wall muscle

• Primary Identifier: Expr5767
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC10660
• Reporter Gene: [F15C11.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCACATGCATCATCCTATTCC] 3' and primer B 5' [GCACTCTCTGTAGCGATCTTAAA] 3'.
• Pattern: Adult Expression: pharynx; unidentified cells in body ; Larval Expression: pharynx; intestine; hypodermis

• Primary Identifier: Expr5764
• Remark: Strain: BC12688
• Reporter Gene: [sad-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTGACCGGGTATTATGAAAAA] 3' and primer B 5' [ACTTTGCCCGATTGACGA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body

• Primary Identifier: Expr5757
• Remark: Strain: BC11539
• Reporter Gene: [F14D12.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATTTTTGGATTTCTTCCTC] 3' and primer B 5' [TAAGGTTCCAGATTATGTGATGTT] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterine muscle; spermatheca; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in body ;unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5736
• Remark: Strain: BC12190
• Reporter Gene: [unc-122::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTTACATCTCATATACTCTGGGC] 3' and primer B 5' [ATTGTGAGCCCAATGAAGTAAAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; coelomocytes; Nervous System; head neurons; pharyngeal neurons; Larval Expression: intestine; rectal gland cells; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in body

• Primary Identifier: Expr5720
• Remark: Strain: BC11217
• Reporter Gene: [F10E7.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCCTGAAAATGTTTGGAAAT] 3' and primer B 5' [GGGAACGAGCGATTGTGTAG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in body ; Larval Expression: intestine; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in body

• Primary Identifier: Expr5593
• Remark: Strain: BC11472
• Reporter Gene: [gpa-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATTTTTGCTGCATTCATTTC] 3' and primer B 5' [GACAGACCCCGATGTTTCC] 3'.
• Pattern: Adult Expression: Reproductive System; vulva other; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in body ; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in body

• Primary Identifier: Expr5598
• Remark: Strain: BC10058
• Reporter Gene: [C56E6.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATGTTTCTCATTCATGATC] 3' and primer B 5' [GGAGATTTTCAAGGAACTTCTGA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: pharynx; intestine; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr5557
• Remark: Strain: BC11840
• Reporter Gene: [C50F2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGCTCACTATCCCCTTGTATT] 3' and primer B 5' [TTTTCTTTGTCGGCGATTATCT] 3'.
• Pattern: Adult Expression: pharynx; intestine - anterior cells; Reproductive System; vulval muscle; hypodermis; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; intestine - anterior cells; hypodermis; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
entity of anatomical origin that is either entirely acellular or is a collection of cells and acellular parts.	Anatomy	anatomical structure	WBbt:0005766