Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ;
Primary Identifier
Expr5764
Remark
Strain: BC12688
Reporter Gene
[sad-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTGACCGGGTATTATGAAAAA] 3' and primer B 5' [ACTTTGCCCGATTGACGA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.
External Links
No external links.
7 Anatomy Terms
Definition
Name
Synonym
Primary Identifier
neuron with cell body associated with the ventral nerve cord.
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.