Larval Expression: pharynx; Nervous System; head neurons;
Primary Identifier
Expr5904
Remark
Also expressed in (comments from author) : No comments. Strain: BC15001
Reporter Gene
[F28F5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTCAAGTTACGCAATCATTC] 3' and primer B 5' [TGTGACCAGGCATTTTCTATTCT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.
External Links
No external links.
3 Anatomy Terms
Definition
Name
Synonym
Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.